Genetic recombinant collagen-like peptide MJLGG-34 as well as preparation method and application thereof
A MJLGG-34, gene recombination technology, applied in the field of genetic engineering, can solve problems such as health and environmental problems, processability, low rejection, and increased potential risks
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] Construction and Expression of Expression Engineering Bacteria pET-32a-MJLGG-34 / BL21(DE3)
[0076] Specific steps are as follows:
[0077] (1) Design and synthesize the MJLGG-34 gene:
[0078] Design the cDNA encoding MJLGG-34 according to the codon preference of Escherichia coli, design two pairs of primers, and use two pairs of complementary primers to anneal to synthesize the MJLGG-34 gene:
[0079] Primer T1+:
[0080] 5'- AATTC GGTGAACCGGGCAACCCAGGTCACAAAGGCCACAAAGGCCAGCCGGGCCAGC-3';
[0081] Primer T1-:
[0082] 5'-CCCGGCTGGCCCGGCTGGCCTTTGTGGCCTTTGTGACCTGGGTTGCCCGGTTCACC G -3';
[0083] Primer T2+:
[0084] 5'-CGGGTCCGCCGGGCGAACGTGGGCCGCCGGGCCCGTGCTGTGGTGGTGGCtaaCTCGAG G -3';
[0085] Primer T2-:
[0086] 5'-GATCC CTCGAG ttaGCCACCACCACAGCACGGGCCCGGCGGCCCACGTTCGCCCGGCGGA-3';
[0087] in, GAATTC is the EcoRI restriction site, CTCGAG It is the XhoI restriction site.
[0088] The amount of each component of annealing: (primer concentration is 1OD di...
Embodiment 2
[0102] Purification, preparation and identification of recombinant human collagen-like peptide MJLGG-34
[0103] Gently invert the bottle several times to mix the medium evenly, pipette 2mL of medium into the column (Ni-NTA column, GenScript Biotechnology Co., Ltd., 10mL column volume), let the medium settle freely, and drain the storage solution , add 4 times column volume of equilibration buffer to equilibrate the chromatographic medium; use the crushed supernatant to go to the column at a flow rate of 1.0mL / min, collect the effluent for subsequent analysis; use 8 times column volume of washing buffer (50mM Na 2 HPO 4 , 0.3M NaCl, 10-50mM imidazole, pH=8.0) through the column at 1.0mL / min to wash away impurities or unaffinity-bound fusion proteins, and collect the effluent for subsequent analysis; use 10 times the column volume The elution buffer was passed through the column at 1.0mL / min, and the eluate was collected from the second tube.
[0104] Get the sample effluent,...
Embodiment 3
[0120] Antioxidant Ability of the Prepared Recombinant Human Collagen-like Peptide MJLGG-34
[0121] (1) The scavenging effect of DPPH
[0122] Take an appropriate amount of polypeptide and dissolve it into a 0.3mM solution with PBS (pH7.5, 0.02M), add 1.5% trypsin to hydrolyze it for 4 hours, then inactivate the enzyme in a boiling water bath for 5 minutes, and stop the hydrolysis to make sample 1; take another appropriate amount of polypeptide with PBS ( pH7.5, 0.02M) was dissolved into a 3mM solution as sample 2.
[0123] Take 0-250 μL of sample 1 and sample 2 into 1.5 mL centrifuge tubes, add 250-500 μL of ethanol solution according to the concentration gradient, then add 1 mL of 0.1mM DPPH·ethanol solution, mix well, place in the dark for 30 minutes, shake continuously, measure 517nm absorbance value at .
[0124] The calculation formula of DPPH·scavenging ability is: DPPH·inhibition rate (%)=(Ao—A1) / Ao×100
[0125] Among them, Ao is the absorbance value of the blank w...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


