Check patentability & draft patents in minutes with Patsnap Eureka AI!

Genetic recombinant collagen-like peptide MJLGG-34 as well as preparation method and application thereof

A MJLGG-34, gene recombination technology, applied in the field of genetic engineering, can solve problems such as health and environmental problems, processability, low rejection, and increased potential risks

Active Publication Date: 2019-04-09
JINAN UNIVERSITY
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditionally extracted collagen contains certain immunogenicity, which increases the potential risk of its application. The racemization and the use of toxic reagents in the synthesis process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic recombinant collagen-like peptide MJLGG-34 as well as preparation method and application thereof
  • Genetic recombinant collagen-like peptide MJLGG-34 as well as preparation method and application thereof
  • Genetic recombinant collagen-like peptide MJLGG-34 as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] Construction and Expression of Expression Engineering Bacteria pET-32a-MJLGG-34 / BL21(DE3)

[0076] Specific steps are as follows:

[0077] (1) Design and synthesize the MJLGG-34 gene:

[0078] Design the cDNA encoding MJLGG-34 according to the codon preference of Escherichia coli, design two pairs of primers, and use two pairs of complementary primers to anneal to synthesize the MJLGG-34 gene:

[0079] Primer T1+:

[0080] 5'- AATTC GGTGAACCGGGCAACCCAGGTCACAAAGGCCACAAAGGCCAGCCGGGCCAGC-3';

[0081] Primer T1-:

[0082] 5'-CCCGGCTGGCCCGGCTGGCCTTTGTGGCCTTTGTGACCTGGGTTGCCCGGTTCACC G -3';

[0083] Primer T2+:

[0084] 5'-CGGGTCCGCCGGGCGAACGTGGGCCGCCGGGCCCGTGCTGTGGTGGTGGCtaaCTCGAG G -3';

[0085] Primer T2-:

[0086] 5'-GATCC CTCGAG ttaGCCACCACCACAGCACGGGCCCGGCGGCCCACGTTCGCCCGGCGGA-3';

[0087] in, GAATTC is the EcoRI restriction site, CTCGAG It is the XhoI restriction site.

[0088] The amount of each component of annealing: (primer concentration is 1OD di...

Embodiment 2

[0102] Purification, preparation and identification of recombinant human collagen-like peptide MJLGG-34

[0103] Gently invert the bottle several times to mix the medium evenly, pipette 2mL of medium into the column (Ni-NTA column, GenScript Biotechnology Co., Ltd., 10mL column volume), let the medium settle freely, and drain the storage solution , add 4 times column volume of equilibration buffer to equilibrate the chromatographic medium; use the crushed supernatant to go to the column at a flow rate of 1.0mL / min, collect the effluent for subsequent analysis; use 8 times column volume of washing buffer (50mM Na 2 HPO 4 , 0.3M NaCl, 10-50mM imidazole, pH=8.0) through the column at 1.0mL / min to wash away impurities or unaffinity-bound fusion proteins, and collect the effluent for subsequent analysis; use 10 times the column volume The elution buffer was passed through the column at 1.0mL / min, and the eluate was collected from the second tube.

[0104] Get the sample effluent,...

Embodiment 3

[0120] Antioxidant Ability of the Prepared Recombinant Human Collagen-like Peptide MJLGG-34

[0121] (1) The scavenging effect of DPPH

[0122] Take an appropriate amount of polypeptide and dissolve it into a 0.3mM solution with PBS (pH7.5, 0.02M), add 1.5% trypsin to hydrolyze it for 4 hours, then inactivate the enzyme in a boiling water bath for 5 minutes, and stop the hydrolysis to make sample 1; take another appropriate amount of polypeptide with PBS ( pH7.5, 0.02M) was dissolved into a 3mM solution as sample 2.

[0123] Take 0-250 μL of sample 1 and sample 2 into 1.5 mL centrifuge tubes, add 250-500 μL of ethanol solution according to the concentration gradient, then add 1 mL of 0.1mM DPPH·ethanol solution, mix well, place in the dark for 30 minutes, shake continuously, measure 517nm absorbance value at .

[0124] The calculation formula of DPPH·scavenging ability is: DPPH·inhibition rate (%)=(Ao—A1) / Ao×100

[0125] Among them, Ao is the absorbance value of the blank w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses genetic recombinant collagen-like peptide MJLGG-34 as well as a preparation method and application thereof, and belongs to the technical field of genetic engineering. Comparedwith the traditional natural collagen, the collagen-like peptide MJLGG-34 obtained through genetic recombination has the advantages that the collagen-like peptide MJLGG-34 is small in molecular weight, easy to prepare and stable biological activity, has better transdermal rate and higher biological activity, and is more easily absorbed by skin while guaranteeing the biological activity; the collagen-like peptide MJLGG-34 is good in biocompatibility and biology safety, has excellent biological activity, such as oxidation resistance, apoptosis resistance and melanogenesis inhibiting, can obviously inhibit oxidative damage of skin, regulate melanogenesis and resist ageing, and does not have obvious toxic or side effects; the collagen-like peptide MJLGG-34 can be applied to food, health care products and cosmetics, and is wide in application range, thereby having the excellent application value and industrial prospect. The preparation method is simple, high in production efficiency, low inproduction cost and wide in application prospect.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a gene recombinant human collagen-like peptide MJLGG-34 and its preparation method and application. Background technique [0002] Collagen is the most abundant protein in many animals, with rich diversity and specificity of tissue distribution. Changes in the type, quality and distribution of collagen directly affect the normal function of the animal body, and it has excellent characteristics such as good biocompatibility, low immunogenicity and biodegradability, and is widely used in biomedicine, tissue engineering, food, Cosmetics and other fields have a wide range of applications. Studies have shown that collagen is a functional factor that improves skin moisture content. It can not only supplement the amino acids needed for collagen synthesis, but also repair damaged cells, improve the nutritional status and microenvironment of cells, and rejuvenate t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/78C12N15/12C12N15/70C12P21/06A23L33/18A61K8/64A61Q19/08A61Q19/02
CPCA23L33/18A23V2002/00A61K8/64A61Q19/02A61Q19/08C07K14/78C12N15/70C12P21/06A23V2250/55A23V2200/318
Inventor 马义
Owner JINAN UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More