Unlock instant, AI-driven research and patent intelligence for your innovation.
Gene knockout strain of bovine Escherichia coli based on ngpiwi protein and its construction method
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
An Escherichia coli and gene knockout technology, which is applied in the field of bovine-derived Escherichia coli gene knockout strain and its construction, can solve the problem of no research on the effect of bovine-derived Escherichia coli, and achieves the effects of high screening efficiency, wide application and small plasmid size
Active Publication Date: 2022-04-22
HUAZHONG AGRI UNIV
View PDF3 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
Although the gene editing effect of this system in eukaryotes is still controversial, the effect in bovine E. coli has not been studied
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0088] The specific method for constructing the basic plasmid pSHK5Ts-NgPiwi for bovine Escherichia coli target gene knockout comprises the following steps:
[0089] 1) Using SEQ ID No.2 and SEQ ID No.3 as templates to design NgPiwi fragments and RBS fragment amplification fusion primers and identification primers for NgPiwi fragments respectively; respectively:
[0090] NgPiwi forward and reverse amplification primers:
[0096] Primers to identify NgPiwi fusions to the plasmid:
[0097] NgPiwi-JD-F: CAACCCGGTAAGACACGACTTATC,
[0098] NgPiwi-JD-R: ATCTGTAACATCATTGGCAACGC;
[0099] 2) Design fusion primers using plasmid pSHK5Ts and NgPiwi-RBS fragments as templates, respectively
[0100] Primers for amplifyi...
Embodiment 2
[0141] The acquisition of the bovine Escherichia coli aste gene ORF sequence deletion strain Δaste-Ecoli comprises the following steps:
[0142] 1) Use the ORF sequence of the succinylglutamic acid desuccinylation gene encoding the argininemetabolic pathway + 1000 bp sequences upstream and downstream (abbreviated aste gene ORF sequence and 300 bp upstream and downstream sequences) as shown in SEQ ID No.4 , design primers for knocking out the ORF sequence of the aste gene, respectively:
[0143] Left homology arm forward and reverse primers:
[0149] The primers on both sides of the left and right homology arms of the ORF sequence of the succinylglutamic acid desuccinylation gene ORF sequen...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a bovine Escherichia coli gene knockout strain mediated by Ngpiwi protein and a construction method thereof; the bovine Escherichia coli gene knockout strain is a potential virulence-related gene deleted on the bovine Escherichia coli genome ORF sequence or partial sequence deletion strains. This method first successfully constructs a recombinant plasmid with Ngpiwi and the left and right homology arms of the target gene sequence to be deleted; secondly, chemically transforms the recombinant plasmid into bovine Escherichia coli, induces double-crossover recombination at 28°C, and screens out the deleted target gene by PCR sequence, and then induce the loss of the plasmid in an antibiotic-free medium at 37°C, so as to obtain a strain lacking the sequence related to the potential virulencegene. The genetic operating system has small plasmids, easy operation, wide application, no potential off-target effects, high knockout efficiency, and no resistance gene selection markers. It provides an excellent tool for the development of bovine E. coli genetic engineering vaccines.
Description
technical field [0001] The invention relates to the technical field of veterinary biological products, in particular to a bovine Escherichia coligene knockout strain mediated by Ngpiwi protein and a construction method thereof. Background technique [0002] Bovine colibacillosis is a disease characterized by diarrhea caused by pathogenic Escherichia coli infecting yaks. The incidence of the disease is about 10.1%, the mortality rate is 2.5%, and the fatality rate is 45%, which seriously threatens the health of yaks. And the economic interests of farmers, restricting the healthy and rapid development of Tibet's economy, often causing incalculable economic losses to farmers and farmers. [0003] Escherichia coli is one of the important diseases that seriously endanger the yak breeding industry. Due to its complex serotype and the extensive use of antibiotics, the drug-resistant strains are constantly increasing, which has a negative impact on the normal intestinal flora and h...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More