Cultivation and application methods of arabidopsis xpo1a/xpo1b+- double mutant
A technology of m-xpo1a-rp and m-xpo1b-rp, applied in the field of Arabidopsis thaliana cultivation, can solve the problems of restricting the use of anti-TuMV varieties, long cycle, low efficiency, etc., and is beneficial to subsequent scientific research and field application, genetic The effect of clear background and stable antiviral properties
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0041] A method for cultivating an Arabidopsis xpo1a / xpo1b double mutant, specifically comprising the following steps:
[0042] (1) Obtain the Arabidopsis thaliana xpo1a mutant (Arabidopsis mutant library number: SALK_078639C);
[0043] (2) 20 days after sowing, DNA and RNA were extracted from the leaves of Arabidopsis thaliana plants of the xpo1a mutant by the CTAB method and the Trizol method;
[0044] (3) Utilize the primer pair LBb1.3-F and m-xpo1a-RP, m-xpo1a-LP and m-xpo1a-RP, and use the extracted DNA as a template for PCR amplification to determine the homozygous situation of the xpo1a mutant (due to T - DNA insertion, LBb1.3-F and m-xpo1a-RP can amplify DNA fragments of specific length, but m-xpo1a-LP and m-xpo1a-RP cannot amplify DNA fragments of specific length). The primer sequences used were:
[0045] LBb1.3-F (tcgcttgtgaatattgtgcag)
[0046] m-xpo1a-LP (atcaaggcagggaaacaaaac)
[0047] m-xpo1a-RP (tgggcagaaatcataggacag); as shown in SEQ ID: No.3-5;
[0048] The...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

