Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of cultivation method and application of Arabidopsis xpo1a/xpo1b± double mutant

A technology of m-xpo1a-rp and m-xpo1a-lp, applied in the field of Arabidopsis thaliana, can solve the problems of restricting the use of TuMV-resistant varieties, long cycle, low efficiency, etc., so as to facilitate follow-up scientific research and field application, genetic Effect of clear background and stable antiviral properties

Active Publication Date: 2021-04-20
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the prevention and control of TuMV mainly relies on resistant varieties, but relying on finding resistant varieties in nature has the following problems: (1) the cycle is long, and it usually takes a long time to find TuMV-resistant varieties in the field; (2) the efficiency is low, and nature Limited availability of resistant cultivars in the

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of cultivation method and application of Arabidopsis xpo1a/xpo1b± double mutant
  • A kind of cultivation method and application of Arabidopsis xpo1a/xpo1b± double mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0041] A method for cultivating an Arabidopsis xpo1a / xpo1b double mutant, specifically comprising the following steps:

[0042] (1) Obtain the Arabidopsis thaliana xpo1a mutant (Arabidopsis mutant library number: SALK_078639C);

[0043] (2) 20 days after sowing, DNA and RNA were extracted from the leaves of Arabidopsis thaliana plants of the xpo1a mutant by the CTAB method and the Trizol method;

[0044] (3) Utilize the primer pair LBb1.3-F and m-xpo1a-RP, m-xpo1a-LP and m-xpo1a-RP, and use the extracted DNA as a template for PCR amplification to determine the homozygous situation of the xpo1a mutant (due to T - DNA insertion, LBb1.3-F and m-xpo1a-RP can amplify DNA fragments of specific length, but m-xpo1a-LP and m-xpo1a-RP cannot amplify DNA fragments of specific length). The primer sequences used were:

[0045] LBb1.3-F (tcgcttgtgaatattgtgcag)

[0046] m-xpo1a-LP (atcaaggcagggaaacaaaac)

[0047] m-xpo1a-RP (tgggcagaaatcataggacag); as shown in SEQ ID: No.3-5;

[0048] The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cultivation method and application of an Arabidopsis thaliana xpo1a / xpo1b ± double mutant. The cultivation method of the invention crosses the xpo1a mutant and the xpo1b mutant by means of genetic hybridization, and screens offspring to obtain Arabidopsis thaliana xpo1a / xpo1b ± double mutant. The T3 generation Arabidopsis xpo1a / xpo1b± double mutant plant obtained by the method of the invention can significantly hinder the infection of the turnip mosaic virus (TuMV).

Description

technical field [0001] The invention relates to the technical field of Arabidopsis thaliana cultivation, in particular to a method for cultivating Arabidopsis thaliana xpo1a / xpo1b± double mutants. Background technique [0002] Turnip mosaic virus (TuMV) is the main pathogen of virus diseases of cruciferous vegetables and rapeseed in my country. One of the most important plant viruses. At present, the prevention and control of TuMV mainly relies on resistant varieties, but relying on finding resistant varieties in nature has the following problems: (1) the cycle is long, and it usually takes a long time to find TuMV-resistant varieties in the field; (2) the efficiency is low, and nature A limited number of resistant cultivars exist in , severely limiting the use of TuMV-resistant cultivars. Contents of the invention [0003] The object of the present invention is to provide a cultivation method and application of Arabidopsis thaliana xpo1a / xpo1b ± double mutant. [0004] ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895A01H1/02A01H1/04
CPCA01H1/02A01H1/04C12Q1/6895C12Q2600/13C12Q2600/156C12Q2600/158
Inventor 李方方周雪平张明振
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More