A kind of cultivation method and application of Arabidopsis xpo1a/xpo1b± double mutant
A technology of m-xpo1a-rp and m-xpo1a-lp, applied in the field of Arabidopsis thaliana, can solve the problems of restricting the use of TuMV-resistant varieties, long cycle, low efficiency, etc., so as to facilitate follow-up scientific research and field application, genetic Effect of clear background and stable antiviral properties
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0041] A method for cultivating an Arabidopsis xpo1a / xpo1b double mutant, specifically comprising the following steps:
[0042] (1) Obtain the Arabidopsis thaliana xpo1a mutant (Arabidopsis mutant library number: SALK_078639C);
[0043] (2) 20 days after sowing, DNA and RNA were extracted from the leaves of Arabidopsis thaliana plants of the xpo1a mutant by the CTAB method and the Trizol method;
[0044] (3) Utilize the primer pair LBb1.3-F and m-xpo1a-RP, m-xpo1a-LP and m-xpo1a-RP, and use the extracted DNA as a template for PCR amplification to determine the homozygous situation of the xpo1a mutant (due to T - DNA insertion, LBb1.3-F and m-xpo1a-RP can amplify DNA fragments of specific length, but m-xpo1a-LP and m-xpo1a-RP cannot amplify DNA fragments of specific length). The primer sequences used were:
[0045] LBb1.3-F (tcgcttgtgaatattgtgcag)
[0046] m-xpo1a-LP (atcaaggcagggaaacaaaac)
[0047] m-xpo1a-RP (tgggcagaaatcataggacag); as shown in SEQ ID: No.3-5;
[0048] The...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


