Cultivation and application methods of arabidopsis nbr1/atg8f double mutant
A technology of nbr1, cultivation method, applied in the fields of application, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problems of host plant damage, unclear disease resistance mechanism, low efficiency, etc., and achieve stable antiviral characteristics, Conducive to follow-up scientific research and field application, with clear genetic background
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0041] A method for cultivating an Arabidopsis nbr1 / atg8f double mutant, specifically comprising the following steps:
[0042] (1) Obtain the Arabidopsis thaliana nbr1 mutant (Arabidopsis mutant library number: SALK_135513);
[0043] (2) 20 days after sowing, DNA and RNA were extracted from the leaves of Arabidopsis plants of the nbr1 mutant by the CTAB method and the Trizol method;
[0044] (3) Utilize the primer pair LBb1.3-F and m-nbr1-RP, m-nbr1-LP and m-nbr1-RP, and use the extracted DNA as a template for PCR amplification to determine the homozygous situation of the nbr1 mutant (due to T - DNA insertion, LBb1.3-F and m-nbr1-RP can amplify DNA fragments of specific length, but m-nbr1-LP and m-nbr1-RP cannot amplify DNA fragments of specific length). The primer sequences used were:
[0045] LBb1.3-F (TCGCTTGTGAATATTGTGCAG)
[0046] m-nbr1-LP (GGAGGCATTAAGGTTCAGTCC)
[0047] m-nbr1-RP (TCGCTTGTGAATATTGTGCAG); as shown in SEQ ID: No.3-5;
[0048] Then use the following ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com