Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cultivation and application methods of arabidopsis nbr1/atg8f double mutant

A technology of nbr1, cultivation method, applied in the fields of application, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problems of host plant damage, unclear disease resistance mechanism, low efficiency, etc., and achieve stable antiviral characteristics, Conducive to follow-up scientific research and field application, with clear genetic background

Active Publication Date: 2019-08-23
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are the following problems in finding disease-resistant varieties from nature: (1) low efficiency, although there are certain virus-resistant varieties in nature, the target range is too large to be difficult to find; (2) resistance is single, resistance is unstable, The mechanism of disease resistance is not clear, so that TuMV can still overcome the resistance of the host, achieve successful infection, and cause devastating damage to the host plant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cultivation and application methods of arabidopsis nbr1/atg8f double mutant
  • Cultivation and application methods of arabidopsis nbr1/atg8f double mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0041] A method for cultivating an Arabidopsis nbr1 / atg8f double mutant, specifically comprising the following steps:

[0042] (1) Obtain the Arabidopsis thaliana nbr1 mutant (Arabidopsis mutant library number: SALK_135513);

[0043] (2) 20 days after sowing, DNA and RNA were extracted from the leaves of Arabidopsis plants of the nbr1 mutant by the CTAB method and the Trizol method;

[0044] (3) Utilize the primer pair LBb1.3-F and m-nbr1-RP, m-nbr1-LP and m-nbr1-RP, and use the extracted DNA as a template for PCR amplification to determine the homozygous situation of the nbr1 mutant (due to T - DNA insertion, LBb1.3-F and m-nbr1-RP can amplify DNA fragments of specific length, but m-nbr1-LP and m-nbr1-RP cannot amplify DNA fragments of specific length). The primer sequences used were:

[0045] LBb1.3-F (TCGCTTGTGAATATTGTGCAG)

[0046] m-nbr1-LP (GGAGGCATTAAGGTTCAGTCC)

[0047] m-nbr1-RP (TCGCTTGTGAATATTGTGCAG); as shown in SEQ ID: No.3-5;

[0048] Then use the following ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses cultivation and application methods of an arabidopsis nbr1 / atg8f double mutant. The cultivation method comprises determining that arabidopsis nbr1 and atg8f mutants can inhibitinfection turnip mosaic virus (TuMV), then crossing the arabidopsis nbr1 and atg8f mutants through genetic hybridization and screening offspring to obtain the arabidopsis nbr1 / atg8f double mutant. The obtained T3-generation arabidopsis nbr1 / atg8f double mutant plant can significantly inhibit infection of TuMV.

Description

technical field [0001] The invention relates to the technical field of Arabidopsis thaliana cultivation, in particular to a method for cultivating the Arabidopsis thaliana nbr1 / atg8f double mutant. Background technique [0002] Turnip mosaic virus (TuMV) is one of the most important plant viruses in agricultural production. It is currently known to infect at least 318 dicotyledonous plant species in 43 families, and it is seriously harmful in 28 countries and regions. The virus is the main pathogen of virus diseases of cruciferous vegetables and rapeseed in my country, which occurs in most areas of China, and can cause 50% to 100% yield reduction when the damage is serious. TuMV is widely distributed in North America, Europe, South Africa, Asia, Australia and other parts of the world. Under natural conditions, TuMV mainly infects cruciferous crops and vegetables such as rapeseed, cabbage, Chinese cabbage, and broccoli. Plants infected with TuMV will show severe symptoms, i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01H1/02C12Q1/6895
CPCA01H1/02C12Q1/6895
Inventor 李方方周雪平张明振
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products