circRNA (circular Ribonucleic Acid) related to adipose derived stem cell osteogenic differentiation, and application of circRNA
A technology of adipose stem cells and human adipose stem cells, applied in the field of biomedicine, can solve the problems of unknown multidirectional differentiation mechanism and low differentiation efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] 1. Key circRNA screening method for osteogenic differentiation of human adipose stem cells:
[0051] (1) The fat obtained by abdominal liposuction from three different healthy adult women was taken, and human adipose stem cells from three different sources were prepared by the following methods:
[0052]Abdominal adipose tissue was collected and stored in a 20mL sterile syringe for later use, and stored in ice packs. Adipose tissue was centrifuged in a 50mL centrifuge tube at 1000rpm / 5min to remove the lower liquid. Adipose tissue was digested with 0.2% type I collagenase at a ratio of 1:1 for 40 minutes on a shaker at 37°C. After standing still, it could be seen that it was divided into three layers. Remove the upper grease layer, fully shake and filter (200 mesh filter). Then centrifuge at 1000rmp / 5min for three times to remove the supernatant liquid, and the cell sediment therein can be seen. Pipette the cells evenly with cell culture medium. Cells were then seed...
Embodiment 2
[0067] Real-time fluorescence quantitative assay confirmed that hsa-circ-0006618 was up-regulated in osteogenic differentiation samples.
[0068] 1. Materials and methods:
[0069] Trizol (Invitrogen)
[0070] RNase Inhibitor (Epicentre)
[0071] SuperScript™ III Reverse Transcriptase (Invitrogen)
[0072] 5×RT buffer (Invitrogen)
[0073] 2.5mM dNTP mix (2.5mM each of dATP, dGTP, dCTP and dTTP) (HyTest Ltd)
[0074] Primer (Yingjun Biotechnology Co., Ltd.)
[0075] 2X PCR master mix (Arraystar)
[0076] Circular RNA hsa-circ-0006618 specific forward primer:
[0077] 5'CCAGAATGACAAGCATACTGGC 3'
[0078] Circular RNA hsa-circ-0006618 specific reverse primer:
[0079] 5'TTCCTTTAACTTCATCCTGCTGG 3'
[0080] Specific forward primer for internal reference GAPDH:
[0081] 5'GGGAAACTGTGGCGTGAT3'
[0082] Specific reverse primer for internal reference GAPDH:
[0083] 5'GAGTGGGTGTCGCTGTTGA3'
[0084] All cDNA samples were configured in Realtime PCR reaction system. The sys...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


