circRNA (circular Ribonucleic Acid) related to adipose derived stem cell osteogenic differentiation, and application of circRNA

A technology of adipose stem cells and human adipose stem cells, applied in the field of biomedicine, can solve the problems of unknown multidirectional differentiation mechanism and low differentiation efficiency

Inactive Publication Date: 2019-12-13
THE FIRST HOSPITAL OF CHINA MEDICIAL UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In terms of the multi-directional differentiation potential of ADSCs, its multi-directional differentiation mechanism is unknown, which determines its low differentiation efficiency, which directly limits its application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • circRNA (circular Ribonucleic Acid) related to adipose derived stem cell osteogenic differentiation, and application of circRNA
  • circRNA (circular Ribonucleic Acid) related to adipose derived stem cell osteogenic differentiation, and application of circRNA
  • circRNA (circular Ribonucleic Acid) related to adipose derived stem cell osteogenic differentiation, and application of circRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] 1. Key circRNA screening method for osteogenic differentiation of human adipose stem cells:

[0051] (1) The fat obtained by abdominal liposuction from three different healthy adult women was taken, and human adipose stem cells from three different sources were prepared by the following methods:

[0052]Abdominal adipose tissue was collected and stored in a 20mL sterile syringe for later use, and stored in ice packs. Adipose tissue was centrifuged in a 50mL centrifuge tube at 1000rpm / 5min to remove the lower liquid. Adipose tissue was digested with 0.2% type I collagenase at a ratio of 1:1 for 40 minutes on a shaker at 37°C. After standing still, it could be seen that it was divided into three layers. Remove the upper grease layer, fully shake and filter (200 mesh filter). Then centrifuge at 1000rmp / 5min for three times to remove the supernatant liquid, and the cell sediment therein can be seen. Pipette the cells evenly with cell culture medium. Cells were then seed...

Embodiment 2

[0067] Real-time fluorescence quantitative assay confirmed that hsa-circ-0006618 was up-regulated in osteogenic differentiation samples.

[0068] 1. Materials and methods:

[0069] Trizol (Invitrogen)

[0070] RNase Inhibitor (Epicentre)

[0071] SuperScript™ III Reverse Transcriptase (Invitrogen)

[0072] 5×RT buffer (Invitrogen)

[0073] 2.5mM dNTP mix (2.5mM each of dATP, dGTP, dCTP and dTTP) (HyTest Ltd)

[0074] Primer (Yingjun Biotechnology Co., Ltd.)

[0075] 2X PCR master mix (Arraystar)

[0076] Circular RNA hsa-circ-0006618 specific forward primer:

[0077] 5'CCAGAATGACAAGCATACTGGC 3'

[0078] Circular RNA hsa-circ-0006618 specific reverse primer:

[0079] 5'TTCCTTTAACTTCATCCTGCTGG 3'

[0080] Specific forward primer for internal reference GAPDH:

[0081] 5'GGGAAACTGTGGCGTGAT3'

[0082] Specific reverse primer for internal reference GAPDH:

[0083] 5'GAGTGGGTGTCGCTGTTGA3'

[0084] All cDNA samples were configured in Realtime PCR reaction system. The sys...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a circRNA (circular Ribonucleic Acid) related to adipose derived stem cell osteogenic differentiation, and an application of the circRNA. The circbase ID of the circRNA is hsa_circ_0006618. A correlation between the expression level of the RNA has-circ-0006618 and the osteogenic differentiation is analyzed, and a result indicates that the circRNA has-circ-0006618 is up-regulated in an oosteogenic differentiation sample. The circRNA is subjected to target gene prediction to indicate that the circRNA participates in an osteogenic differentiation pathway, so that a detection preparation which aims at the circRNA is used for predicting the differentiation of a human adipose derived stem cell to osteoblast, meanwhile, the differentiation of the human adipose derived stem cell to the osteoblast through induction by the circRNA has-circ-0006618 can be used for repairing bone wounds and is favorable for clinic treatment.

Description

Technical field: [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a differential expression profile of circRNA in osteogenic differentiation of adipose stem cells and its screening application. Background technique: [0002] Adipose Derived Stem Cells (ADSCs) have attracted extensive attention in recent years. Compared with bone marrow mesenchymal stem cells (BMSCs), adipose-derived stem cells have a wide range of sources, more content, easier acquisition methods, and less pain for patients. Adipose-derived stem cells, like bone marrow mesenchymal stem cells, have multiple differentiation abilities, can express the same surface markers, have similar gene structure and the same differentiation potential. Therefore, under appropriate conditions, adipose stem cells can differentiate into fat cells, osteoblasts, chondrocytes, and muscle cells. ADSCs have multi-directional differentiation ability and relatively clear osteogenic po...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/686C12N15/113
CPCC12Q1/6888C12Q1/686C12Q2600/178C12Q2600/158C12Q2561/113C12Q2563/107C12Q2545/114
Inventor郭澍康悦孙强李佳烨陈柏宇
OwnerTHE FIRST HOSPITAL OF CHINA MEDICIAL UNIV