Preparation of fusion protein in deficiency of different structural domains and application of fusion protein to improvement of protein synthesis

A fusion protein and protein synthesis technology, applied in the field of genetic engineering, can solve the problems of low efficiency, slow speed, and limited application of protein synthesis.

Active Publication Date: 2020-02-28
KANGMA SHANGHAI BIOTECH LTD
View PDF3 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Both intracellular and extracellular artificial protein synthesis systems in nature have the characteristics of low efficiency and slow speed, which greatly limits the application of protein synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation of fusion protein in deficiency of different structural domains and application of fusion protein to improvement of protein synthesis
  • Preparation of fusion protein in deficiency of different structural domains and application of fusion protein to improvement of protein synthesis
  • Preparation of fusion protein in deficiency of different structural domains and application of fusion protein to improvement of protein synthesis

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0161] In the present invention, the preparation method of the cell extract is not limited, and a preferred preparation method includes the following steps:

[0162] (i) providing cells;

[0163] (ii) washing the cells to obtain washed cells;

[0164] (iii) performing cell disruption treatment on the washed cells to obtain a crude cell extract;

[0165] (iv) performing solid-liquid separation on the crude cell extract to obtain the liquid part, which is the cell extract.

[0166] In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation.

[0167] In the present invention, the centrifugation conditions are not particularly limited, and a preferred centrifugation condition is 5000-100000×g, preferably 8000-30000×g.

[0168] In the present invention, the centrifugation time is not particularly limited, and a preferred centrifugation time is 0.5min-2h, preferably 20min-50min.

[0169] In the present inventi...

Embodiment 1

[0182] Embodiment 1 Improves the theoretical model of protein synthesis by genetic modification

[0183] In the previous application, the inventors used CRISPR-Cas9 gene editing technology to connect a complete eIF4G protein to the C-terminus of the endogenous PAB1 (KlPAB1) protein in K. lactis, which significantly improved the efficiency of the cell-free in vitro translation system. The eIF4G protein contains multiple domains that interact with different RNA or protein elements. Some of these domains may not be involved in the process of in vitro translation, so this patent constructed a series of eIF4G (KleIF4G-N77Δ (RNA1domain deletion), KleIF4G-N134Δ (region between RNA1+RNA1 and PABP) with different domain deletions deletion), KleIF4G-N305Δ (deletion of region before PABP+PABP), KleIF4G-N566Δ (deletion of region before eIF4E+eIF4E), KleIF4G-C570Δ (deletion of region after RNA2+), KleIF4G-C605Δ (deletion of region after HEAT / eIF4A+ deletion), KleIF4G-C939Δ (RNA3domain del...

Embodiment 2

[0186] Plasmid Construction of Example 2 Deletion of Different Structure Domains

[0187] The construction of the plasmid in this example is completed on the basis of the constructed plasmid in the previous application, and the construction method of the constructed plasmid is detailed in the previous application (application number 2017106425174).

[0188] 1. Construction and amplification of KlPAB1-KleIF4G-N77Δ donor DNA plasmid

[0189] Using the pKM-KlPab1-KleIF4G-DD plasmid in the previous application as a template, PCR amplification was performed with primer PF: TTGGTGGAGGTGGATCTAACCAACCAGCGTACGGTG (SEQ ID NO.: 19) and primer PR: AGATCCACCTCCACCAACAGTAG (SEQ ID NO.: 20). Mix 17 μL of the amplification product, 1 μL of DpnI, and 2 μL of 10×digestion buffer, and incubate at 37°C for 3 hours. Add 10 μL of the DpnI-treated product to 100 μL DH5α competent cells, place on ice for 30 min, heat shock at 42 °C for 45 s, add 1 mL of LB liquid medium and shake at 37 °C for 1 h, s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides preparation of an eIF4G and Pab1 fusion protein in deficiency of different structural domains and application of the fusion protein to improvement of protein synthesis. Particularly, the fusion protein in deficiency of different structural domains is capable of changing in-vitro protein translation efficiency, wherein RNA1 and / or PABP structural domain deficiency of an eIF4Gelement can remarkably improve protein expression. In addition, the invention provides a preparation method of the infusion protein and a corresponding in-vitro protein synthesis system and method.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the preparation of fusion proteins with deletion of different structural domains and its application in improving protein synthesis. [0002] This application is further obtained on the basis of the previous application with application number 2017106425174; the previous applications mentioned below are all patent applications with application number 2017106425174. Background technique [0003] Proteins are important molecules in cells and are involved in almost all functions of cells. Different sequences and structures of proteins determine their different functions. In cells, proteins can be used as enzymes to catalyze various biochemical reactions, and as signal molecules to coordinate various activities of organisms, to support biological forms, store energy, transport molecules, and make organisms move. In the field of biomedicine, protein antibodies, as targeted drugs, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12P21/00
CPCC07K2319/00C07K2319/02C12N9/14C12P21/00C12Y306/04013
Inventor郭敏代田纯欧阳冬冬丁晓辉杨宁于雪
OwnerKANGMA SHANGHAI BIOTECH LTD