Chimeric antigen receptor of anti-human CD123 and application of chimeric antigen receptor

A chimeric antigen receptor and antigen technology, applied in the field of genetic engineering, can solve the problem of loss of antigen-binding activity of antibodies, achieve the effects of no toxic side effects, reduce immunogenicity, and enhance sustainability and safety

Active Publication Date: 2020-04-03
CHONGQING PRECISION BIOTECH CO LTD
View PDF25 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the transformation of antibodies usually leads to the loss of the original antigen-binding activity of the antibody. Therefore, it is necessary to repeatedly modify the key residues that affect the binding of antigens and antibodies, and then screen a large number of antigen-antibody binding specificity and affinity tests to obtain active antibody sequences.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor of anti-human CD123 and application of chimeric antigen receptor
  • Chimeric antigen receptor of anti-human CD123 and application of chimeric antigen receptor
  • Chimeric antigen receptor of anti-human CD123 and application of chimeric antigen receptor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Design of humanized monoclonal antibodies against human CD123 antigen

[0049] (1) The amino acid sequences of the 6 FR regions of the light and heavy chains of the mouse anti-human CD123 monoclonal antibody were analyzed and compared through the IMGT / BLAST database, and the human antibody sequence with the highest homology was selected as the transformation template. The murine antibody scFv sequences are shown in Table 1 below.

[0050] Table 1: Murine Antibody scFv Sequences

[0051]

[0052] (2) After molecular docking simulation, the backbone sequence was humanized and modified to obtain 3 humanized scFvs, the amino acid sequences of which are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3. CAR construction was carried out, and it was verified that although the CAR constructed by the humanized scFv can be normally expressed on the surface of T cells, none of them can work normally, while the CAR of the unmodified mouse scFv combination can work no...

Embodiment 2

[0054] Example 2, Affinity Determination of Humanized Monoclonal Antibody Targeting CD123

[0055] The preferred monoclonal antibody scFv is tagged with His tag and cloned into a plasmid vector and transfected into HEK293 cells, scFv-His is purified, scFv-His and the negative control are diluted in 6 gradients with PBS, and CD123-positive THP-1 cells are incubated respectively, The positive rate of THP-1CD123 detection under the concentration gradient was detected by flow cytometry, and the positive rate of flow cytometry and MFI (mean fluorescence intensity) were counted, and the affinity of different scFvs to CD123 was analyzed. The experiment was repeated three times independently, and the results were as follows: image 3 As shown, the larger the Kd (nM), the smaller the affinity.

Embodiment 3

[0056] Example 3. Preparation of Lentivirus Expressing a Chimeric Antigen Receptor Targeting Human CD123 Antigen

[0057] (1) Prepare the gene sequence of the chimeric antigen receptor targeting human CD123 antigen

[0058] Synthesize chimeric antigen receptor sequence containing leader peptide (also known as signal peptide), anti-human CD123 antigen single-chain antibody ScFv, hFc hinge region, transmembrane region and intracellular signal segment in sequence, its structure is as follows Figure 4 shown. The nucleotide sequence of the leader peptide is atgggatggagctgtatcatcctcttcctggtagcaacagctacaggcgtgcacagt; the nucleotide sequence of the humanized single-chain antibody against human CD123 antigen is as SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO20, SEQ ID NO21, SEQ ID NO22, SEQ ID NO22, SEQ ID NO. ID NO23 and SEQ ID NO24; the nucleotide sequence of the hFc hinge region is an amino acid sequence such as the amino acid sequence corresponding to SEQ ID NO.8 or SEQ ID NO9 or SEQ ID...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and particularly relates to an anti-human CD123 chimeric antigen receptor and an application thereof. The polypeptide for recognizing a CD123 antigen comprises amino acid sequences as shown in SEQ ID NO: 4 to 7, and the polypeptide serving as an antigen recognition region in a (chimeric antigen receptor, CAR) structure can be used for inducing activation of CAR-T cells. After the chimeric antigen receptor of the anti-CD123 antigen is expressed in immune cells, tumor target cells expressing the CD123 antigen can be effectively removed, andthe chimeric antigen receptor has no toxic effect on tumor cells of a negative antigen (not expressing CD123). Moreover, the positive rate of the CD123-targeting CAR in the cell culture process of apatient can be maintained, and the CD123-targeting CAR can be proliferated for a long time after being stimulated by a target antigen and can be used for targeting treatment of tumors.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a chimeric antigen receptor against human CD123 and its application. Background technique [0002] Acute myeloid leukemia (AML) is a malignant disease of myeloid hematopoietic stem / progenitor cells, characterized by abnormal proliferation of primitive and immature myeloid cells in bone marrow and peripheral blood. Timely treatment is often life-threatening; although conventional induction chemotherapy can alleviate AML, it cannot prevent the recurrence of AML and the high mortality rate of relapsed patients. However, the conventional treatment of AML has not changed for 50 years, and it is urgent to find new changes. Chimeric antigen receptor T cell technology has achieved excellent therapeutic effects in the treatment of acute lymphoblastic leukemia (ALL) expressing CD19, but whether its target CD19 molecule is suitable for AML needs to be explored. [0003] CD12...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/867C12N5/10A61K35/17A61P35/00A61P35/02
CPCA61K35/17A61P35/00A61P35/02C07K14/7051C07K14/70521C07K14/70578C07K16/2866C07K2317/24C07K2317/622C07K2317/92C07K2319/00C07K2319/03C07K2319/33C07K2319/74C12N5/0636C12N15/86C12N2510/00C12N2740/15043C12N2800/107
Inventor张巍单娟娟徐艳敏黄霞赵文旭陈军赵永春张茜真
OwnerCHONGQING PRECISION BIOTECH CO LTD