A recombinant antibody against human cardiac troponin I

A technology of cardiac troponin and binding protein, which is applied in the field of immunity and can solve the problems of low activity and poor affinity

Active Publication Date: 2022-04-01
DONGGUAN PENGZHI BIOTECH CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Due to low activity and poor affinity, the existing cTnI antibodies cannot be well applied to the detection of cTnI protein. Therefore, there is a strong demand in this field for antibodies that can effectively and specifically bind to and detect cTnI

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant antibody against human cardiac troponin I

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0119] This example provides an exemplary preparation method of a recombinant antibody against human cardiac troponin I.

[0120] S10, construction of expression plasmids:

[0121] In this embodiment, restriction endonuclease and Prime Star DNA polymerase were purchased from Takara Company;

[0122] MagExtractor-RNA extraction kit was purchased from TOYOBO;

[0123] BD SMART™ RACE cDNA Amplification Kit was purchased from Takara;

[0124] The pMD-18T vector was purchased from Takara;

[0125] The plasmid extraction kit was purchased from Tiangen Company;

[0126] Primer synthesis and gene sequencing were completed by Invitrogen;

[0127] Secreted Anti-cTnI 12D2 monoclonal antibody was used as an existing hybridoma cell line, which was revived for later use.

[0128] S11, design and synthesis of primers:

[0129] 5' RACE upstream primers for amplification of heavy and light chains:

[0130] SMARTER II A Oligonucleotide:

[0131] 5'>AAGCAGTGGTATCAACGCAGAGGTACXXXXX<3';

...

Embodiment 2

[0151] Transient Transfection of Recombinant Antibody Expression Plasmids into CHO Cells and Identification of Antibody Activity in Expression Supernatant

[0152] The plasmid was diluted to 400ng / ml with ultrapure water, and the CHO cells were adjusted to 1.43×10 7 cells / ml in a centrifuge tube, mix 100ul plasmid with 700ul cells, transfer to an electroporation cup, electroporation, transfer to 10ml CD CHO AGT medium, culture in a 37-degree shaker (8% CO 2 , amplitude 150); sampling the cell viability every day, when the cell viability is lower than 50%, centrifuge the cell culture supernatant, and the obtained antibody (with sequences such as light chain and heavy chain shown in SEQ ID NO:11 and 12 ). Take 4µg of purified antibody for reducing SDS-PAGE.

[0153] After analysis, the complementarity determining region (WT) of the heavy chain:

[0154] CDR-VH1 is G-F(X1)-T-F-T-E(X2)-Y-N-V(X3)-H;

[0155] CDR-VH2 is Y-I(X1)-Y-P-N(X2)-N-G-I-S(X3)-G-Y-N-Q;

[0156] CDR-VH3 is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a recombinant antibody against human cardiac troponin I, in particular to a novel isolated binding protein containing cTnI antigen binding domain, and researches on the preparation and application of the binding protein. The binding protein has strong activity and high affinity with human cTnI protein, and can be widely used in the detection field of cTnI protein.

Description

technical field [0001] The invention relates to the technical field of immunization, in particular to a recombinant antibody against human cardiac troponin I. Background technique [0002] Before the 1980s, the World Health Organization (WHO) had always regarded myocardial enzyme activity as one of the diagnostic criteria for acute myocardial infarction (AMI). In the late 1980s, researchers discovered that the sensitivity and specificity of troponin (Tn) was higher than that of phosphocreatine kinase (CK), phosphocreatine kinase isoenzyme (CK-MB), lactate dehydrogenation enzymes and biomarkers such as aspartate aminotransferase. Cardiac troponin I (cTnI) exists only in the myocardium and is a marker of cardiomyocytes. Its abnormal changes can affect the diastolic and systolic functions of the heart, and can be used to diagnose myocardial necrosis and judge myocardial injury. One of the most specific markers is recognized as the main biochemical marker for the rapid diagnos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K16/18C12N15/13G01N33/68
CPCC07K16/18G01N33/6893C07K2317/565C07K2317/92G01N2333/4712G01N2800/324G01N2800/12
Inventor孟媛钟冬梅游辉范凌云
OwnerDONGGUAN PENGZHI BIOTECH CO LTD