67 results about "Troponin" patented technology

According to the preparation and application of the novel Fe monatomic nano enzyme, mesoporous silica is used as a substrate material, the surface of the substrate material is coated with a layer of dopamine and hemin, then high-temperature calcination is performed to form the monatomic nano enzyme Fe-N-C, then the monatomic nano enzyme Fe-N-C is used as a signal reporter molecule of a lateral flow chromatography test strip, and the application of the monatomic nano enzyme Fe-N-C in the lateral flow chromatography test strip is realized. A labeled antibody is connected to the surface of the antibody, so that rapid detection of cardiac troponin I (cTnI) is realized. In the monatomic nano-enzyme, dopamine mainly provides a carbon source, heme mainly provides Fe and a nitrogen source, the larger specific surface area of mesopores provides abundant sites for the monatomic nano-enzyme, and the contact area of the monatomic nano-enzyme and a substrate is increased, so that the enzyme activity is improved. In conclusion, the material has a large specific surface area and relatively high enzyme activity. And finally, quickly detecting the biomarker cTnI after the test strip platform is integrated.

The invention provides an antibody specifically targeting cardiac troponin I. The invention further provides a preparation method of the antibody. The invention further provides an antibody pair comprising the antibody and a kit. The invention further provides the use of these antibodies to detect the level of cardiac troponin I and to diagnose myocardial damage.

Provided herein are gene therapies against PKP2 (spot phenanthrin protein-2), such as the use of adeno-associated virus (AAV) vectors. The promoter of the vector can be an MHCK7 promoter or a cardiac troponin T (cTnT2) promoter. The capsid may be AAV9 or AAVrh.74 or a capsid protein comprising AAV9 or AAVrh.74, or a functional variant thereof. Other promoters or capsids may be used. Also provided are methods of treatment, such as by intravenous, intracoronary, intracarotid, or intracardiac administration of the rAAV vector, as well as other compositions and methods.

The present invention belongs to the fields of novel nanocomposites, immunoassays, and biosensor technologies, and provides a method for preparing a sandwich-type electrochemical immunosensor for cardiac troponin I. The present invention uses highly conductive, gold-particle-loaded, hierarchically porous nitrogen-doped carbon nanotubes (Au NPs / N-CNTs) as a substrate and mesoporous palladium nitrogen nanocubes (meso-PdN NCs) as an electrochemical signal amplification platform to achieve quantitative detection of cardiac troponin I (CTnI) antigen. This method has the advantages of strong specificity, high sensitivity, and a low detection limit, and has important scientific significance and application value for the detection of acute myocardial infarction (AMI).

The application belongs to the technical field of biological detection, and discloses a cardiovascular marker control article and a preparation method thereof. The cardiovascular marker control article comprises a serum matrix, antigens, a preservative and a stabilizer. The antigens include cardiac troponin I antigens, creatine kinase isoenzyme antigens, myoglobin antigens, amino-terminal brain natriuretic peptide precursor antigens, brain natriuretic peptide antigens, D-dimer antigens, heart-type fatty acid-binding protein antigens, myeloperoxidase antigens and lipoprotein phospholipase A2 antigens. The stabilizer includes at least one of D-trehalose, sucrose, glycine, inositol and polyethylene glycol. The cardiovascular marker control article can cover various cardiovascular disease markers, including heart failure, pulmonary embolism, vasculitis and atherosclerosis, myocardial injury, myocardial infarction and the like. The control article can be used as a third-party control article for indoor and inter-laboratory quality control of a cardiovascular disease screening and auxiliary diagnosis measurement system.

The present invention relates to a method for assessing myocardial infarction comprising the steps of determining the amount of a first biomarker in a sample of a subject, said first biomarker being a cardiac Troponin, determining the amount of a second biomarker in a sample of the subject, wherein said second biomarker is selected from the group consisting of: a BMP10-type peptide (Bone Morphogenic Protein 10-type peptide), FGF23 (Fibroblast growth factor 23), a BNP-type peptide, cardiac myosin binding protein C (cMyBPC) and ANG2 (Angiopoietin 2), comparing the amounts of the biomarkers to references for said biomarkers and / or calculating a score for assessing myocardial infarction based on the amounts of the biomarkers, and assessing said subject based on the comparison and / or the calculation. The invention also relates to the use of a first biomarker being a cardiac Troponin and a second biomarker selected from the group consisting of: a BMP10-type peptide (Bone Morphogenic Protein 10-type peptide), FGF23 (Fibroblast growth factor 23), a BNP-type peptide, cardiac myosin binding protein C (cMyBPC) and ANG2 (Angiopoietin 2), or at least one detection agent for said first biomarker and at least one detection agent for said second biomarker for assessing myocardial infarction. Moreover, the invention further relates to a computer-implemented method for assessing myocardial infarction and a device and a kit for assessing myocardial infarction.

The present disclosure provides devices, systems incorporating the devices, methods for manufacturing the devices, and methods of using the devices for carrying out assays, such as chemical and / or biological assays. The systems include a wearable device including a biosensor having a plurality of electrodes. A functionalized coating is coupled to an electrode of the biosensor. A controller may sense an electrochemical response of the biosensor, and determine whether a health-related biomarker is present based on the electrochemical response. The functionalized coating may include a sulfonated block copolymer such as sulfonated styrene-isobutylene-styrene (SIBS). The health-related biomarker may include cardiac troponin I (cTnI).

The invention discloses a non-invasive troponin monitoring system, which comprises a signal acquisition module, a filtering processing module, a feature extraction module, a clustering result generation module, a clustering result generation module, a clustering result generation module, a clustering result generation module, a clustering result generation module, a clustering result generation module and a clustering result generation module, wherein the signal acquisition module collects bio-electricity signals and the like to generate a data set, and the filtering processing module calculates a signal-to-noise ratio and adjusts filter bandwidth to output filtering signals. The data fusion module synchronizes the electrocardiogram period to integrate the feature vector, and the calibration output module monitors the environment change and generates a calibrated feature vector. According to the non-invasive troponin monitoring system, an original data set is generated by collecting multi-dimensional signals of a human body and environmental parameters. A dynamic filtering technology is utilized to optimize a signal-to-noise ratio, accurately extract time domain and frequency domain features and perform clustering analysis, an electrocardiogram period is synchronously analyzed to realize data fusion, multi-dimensional feature vectors are generated, calibration is performed in combination with environment monitoring data, interference is effectively eliminated, and high precision and stability of a troponin monitoring result are improved.

The invention relates to the field of antibodies, in particular to an anti-troponin I monoclonal antibody and application thereof, performance analysis of a purified electrophoretogram of the antibody and a kit coupled with a monoclonal antibody HK401 coated magnetic particle component shows that the monoclonal antibody has excellent performance in cTni detection, and the cTni detection sensitivity is high. The method can be used as an object for further production and optimization.

The present invention provides methods for determining whether a subject suspected of having a myocardial infarction is suffering from type I or type II myocardial infarction. In particular, systems and methods are provided that employ a probability score based on a decision tree-based algorithm to process the subject's gender, age, and cardiac troponin concentration, as well as the subject's galectin-3 (Gal-3) concentration.

The present invention provides methods for determining whether a subject suspected of having myocardial infarction is experiencing type I myocardial infarction or type II myocardial infarction. In particular, systems and methods are provided for processing the gender, age, and cardiac troponin concentration of a subject, as well as the galectin-3 (Gal-3) concentration of a subject, employing probability scoring based on a decision tree algorithm.

The traditional Chinese medicine composition is characterized by being prepared from the following traditional Chinese medicinal materials in parts by weight: 3 to 9 parts of rhizoma chuanxiong, 3 to 7 parts of rhizoma atractylodis, 6 to 14 parts of rhizoma cyperi, 6 to 14 parts of medicated leaven, 3 to 7 parts of euphorbia helioscopia, 10 to 20 parts of poria cocos, 8 to 12 parts of fructus trichosanthis, 8 to 12 parts of radix salviae miltiorrhizae, 8 to 12 parts of herba epimedii, 3 to 9 parts of pepper, 8 to 12 parts of herba patriniae and 8 to 12 parts of caulis spatholobi. After the traditional Chinese medicine composition is used for treating acute myocardial infarction, a remarkable effect is achieved on PCI postoperative improvement of acute myocardial infarction, troponin and creatine kinase isoenzyme indexes are reduced, and the left ventricular ejection fraction is in a normal range after cardiac color ultrasound display treatment. Through comprehensive conditioning, symptoms such as chest distress, chest pain, shortness of breath and hypodynamia of patients are improved, cardiac function recovery is promoted, complications such as restenosis and heart failure are prevented, and life quality is improved.

This invention relates to the field of biomedical technology, specifically to the application of PTPRM in the treatment and / or prevention of septic cardiomyopathy. This application found that the expression level of PTPRM was significantly reduced in the cardiac tissue of a CLP model, and further verified that overexpression of PTPRM significantly improved the survival rate of the CLP model. Furthermore, the reduction in PAT caused by CLP modeling, as well as the increases in RVDFW, RVSFW, LVSFW, LVDFW, IVS-s, and IVS-d, were also improved. In addition, overexpression of PTPRM can also reduce the expression level of cardiac troponin (cTNT) and right ventricular wall thickness. Therefore, PTPRM can be used as a target for the treatment of septic cardiomyopathy.

The invention relates to the field of intelligent medical treatment, in particular to a pregnancy disease risk prediction method and device based on biochemical indexes and a program product. Comprising the following steps: S1, acquiring serum biochemical index data of a pregnant woman; s2, comparing the serum biochemical indexes with a preset threshold value; the serum biochemical indexes include aspartate aminotransferase, total protein, albumin, lactic dehydrogenase, alkaline phosphatase, total bile acid, creatine kinase, blood sugar, urea nitrogen, uric acid, creatinine, glomerular filtration rate, potassium, chlorine, total calcium, serum magnesium, inorganic phosphorus, total cholesterol, triglyceride, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol and homocysteine. When one or more of the myoglobin, the hypersensitive troponin I, the prealbumin, the cystatin C and the creatine kinase isoenzyme MB are abnormal, judging that the pregnancy eclampsia exists. The method is simple, convenient and rapid to operate and low in cost, can be clinically popularized to predict the health state of the pregnant woman on a large scale, and has good clinical value.

According to this invention, there is provided an automated sample preparation system implemented within a disposable cartridge. The system utilizes finger prick blood or venous blood as an input sample and performs various sample processing steps, including fluidic metering, fluidic routing, and reagent storage with an integrated biosensor. The architecture, of this system, enables efficient and accurate testing of blood parameters, hematology parameters such as CBC, CD4-T cells count, but not limited to, Complete Blood Cell Count (CBC) and measurement of biomarkers such as Troponin, IL-6, Procalcitonin, but not limited to, CRP, Procalcitonin, and IL-6 through ELISA and is flexible to implement other electrochemistry techniques.

This invention describes a novel gene regulatory sequence containing the promoter and enhancer sequences of the human cardiac troponin T gene (TNNT2) that selectively induces expression in cardiomyocytes. This novel TNNT2 promoter / enhancer composition can be used to induce adeno-associated virus gene expression, construct cell-type-specific expression vectors, or perform cardiac-specific transgenesis. The use of this novel promoter / enhancer composition is demonstrated by the expression of mAKAP shRNA and a mAKAP-derived anchor-disrupting peptide useful for the treatment of heart failure.

The invention relates to the technical field of immunoassay, and discloses a chemiluminescence immunoassay method for high-sensitivity detection of cardiac troponin I. The chemiluminescence immunoassay method comprises the following steps: fixing an anti-cardiac troponin I capture antibody based on a solid phase carrier; a sample to be detected is in contact with the solid phase carrier coated with the capture antibody, a detection antibody is added, the detection antibody is connected with a signal marker, and the signal marker is a compound formed by loading alkaline phosphatase on a nano material or is the nano material; a chemiluminescent substrate is added, and the chemiluminescent substrate is a compound based on 1, 2-dioxetane; detecting a chemiluminescence signal so as to quantify cardiac troponin I; according to the invention, the problem of non-uniform detection of degradation fragments is solved, and the diagnosis window period is prolonged; meanwhile, extremely high detection sensitivity, signal-to-noise ratio and stability are realized, and the kit is suitable for early and accurate diagnosis of myocardial injury.

The invention discloses a high-risk chest pain prediction analysis method and device based on machine learning and a readable medium, and relates to the field of data analysis, and the method comprises the steps: carrying out the data enhancement and denoising of a data set through employing an SMOTE-ENN; screening baseline features in the processed data set by using a sequence forward selection method based on feature importance of a tree model, and verifying the validity of the screened features by using a Boruta algorithm to obtain important features; acquiring values of important features of a to-be-predicted chest pain patient, and inputting the values into the trained chest pain risk layering prediction model to obtain a corresponding chest pain risk layering result; and determining the maximum value of troponin in the important features as the feature influencing the prediction result of the chest pain risk hierarchical prediction model through SHAP analysis, analyzing the relationship between the maximum value of troponin and the death rate in the hospital, and determining the numerical value of the maximum value of troponin corresponding to the maximum death rate in the hospital. The problem of low accuracy of chest pain risk layered prediction is solved.

The invention relates to a spatial proximity chemiluminescence kit for detecting troponin I and a preparation method thereof, and relates to the technical field of biology. The kit comprises an enzyme marker, a luminous marker, a luminous auxiliary agent and a triggering agent, the enzyme marker comprises an anti-cTnI monoclonal antibody marked by horse radish peroxidase, and the luminous marker comprises an anti-cTnI monoclonal antibody marked by 9, 10-dihydroacridine. The kit adopts a space adjacent chemical double-antibody sandwich method, is simple to operate, can realize full-automatic detection, does not need magnetic beads and washing, reduces the reagent cost, shortens the detection time, adopts a homogeneous reaction, and has the advantages of high detection accuracy, high sensitivity, high sensitivity and the like by being compared with other methods such as enzyme-linked immunosorbent assay and fluorescence immunochromatography. The influence caused by the traditional chemiluminescence magnetic separation technology is avoided, so that the detection result is more accurate and stable.

Embodiments of the present invention relates to an apparatus for monitoring cardiovascular diseases comprising an implantable mechanical sensor (1) for detecting strain levels of a heart; an implantable or wearable microneedle-based chemical sensor (2) for detecting level of cardiac biomarkers such as troponin; at least a wireless communication unit for transmitting the mechanical sensor (1) and / or chemical sensor (2) readings.

The invention relates to the technical field of biomedicine and cardiovascular disease treatment, and discloses application of an Aralar myocardial overexpression virus in preparation of a medicine for treating heart failure. The related product is a gene therapy preparation containing an effective amount of AAV9-cTnT-Aralar, and can be matched with pharmaceutically acceptable carriers, diluents and other auxiliary materials, and the preparation is an injection type. The preparation method comprises the following steps: firstly, constructing a cardiac troponin T-carrying promoter and an AAV9 carrier of an Aralar coding nucleic acid to form a recombinant adeno-associated virus, and then matching the virus with proper auxiliary materials to prepare the preparation. The product can be used for treating heart failure accompanied with mitochondrial dysfunction, can realize heart targeted delivery and myocardial cell specific overexpression of Aralr, relieves the heart failure course by improving the myocardial cell mitochondrial function and dynamic balance, and is good in preparation stability, convenient in administration and adaptive to clinical application requirements.

The application discloses an antibody for detecting cardiovascular diseases and application thereof, and belongs to the technical field of biological medicine. The monoclonal antibody or antigen binding fragment thereof provided by the application can specifically bind to a specific antigen epitope (SEQ ID NO:1) of human cardiac troponin I (cTnI) and has no cross reaction with skeletal muscle troponin I. The application further discloses the CDR sequences of the heavy chain and light chain variable regions of the antibody, a coding gene, a preparation method and application thereof. An ELISA detection kit containing the antibody can specifically recognize cTnI in a blood sample, has good linearity in the range of 0.01-50 ng / mL, has a false negative rate of 0 for serum detection of patients with acute myocardial infarction, and has a low false positive rate for serum detection of healthy people. The antibody and the kit have important application value in rapid and accurate diagnosis of cardiovascular diseases such as acute myocardial infarction.

This invention discloses a novel cardiac troponin I combined detection kit, belonging to the field of reagent kit technology. It includes a reagent shell with a mounting base fixed inside. The mounting base has a set of test tube holes inside, and a set of support components at the bottom of the mounting base to raise the height of the test tubes inside the test tube holes. In this novel cardiac troponin I combined detection kit, rotating a transmission wheel causes a threaded rod to move a transmission block. A support rod and connecting block move a connecting plate upwards, causing a top rod to slide inside the test tube holes. This allows the test tubes inside the holes to move upwards, raising the top of the test tubes above the top surface of the reagent shell for easy handling. A first compression spring pushes a positioning hook, causing its tip to engage with a slot. Simultaneously, a second compression spring pushes a pressure rod to support the positioning rod, positioning it between the positioning hook and the pressure rod, thus fixing the position of the top cover.

The present invention relates to an improved variant monoclonal antibody binding to cardiac troponin T and having a better KD than the parent monoclonal antibody 11-7.

The present disclosure provides methods for determining the presence of troponin megaterium in a biological sample obtained from a subject.

The invention discloses an Aps3-PS (at) CP electrochemical sensor for detecting serum troponin I as well as a construction method and application of the Aps3-PS (at) CP electrochemical sensor. The preparation method comprises the following steps: combining Aps3-CTnI on conductive paper PS (at) CP; the sequence of the Aps3-CTnI is shown as follows: 5 '-AT ATATAT / Sp18 / / Sp18 / Sp18 / CGTGCAGTACGCCAACCTTCTCTGCGCTGCCCCTT TT TT A-3', and the Sp18 is a hexaethylene glycol spacer of 18 atoms. The invention provides the Aps3-PS (CP) electrochemical sensor for detecting the serum CTnI, and the sensitivity and the specificity of the electrochemical sensor based on an aptamer for detecting the CTnI can be greatly improved.

This invention belongs to the fields of novel functional nanomaterials, immunoassays, and biosensors. It provides a dual-mode immunosensor based on a PdSn bifunctional nanozyme for the sensitive detection of cardiac troponin I (cTnI). A palladium-tin alloy / molybdenum carbide composite (PdSn / Mo2C-C) as a secondary antibody beacon and a gold nanoparticle / hydrogen-bonded organic framework composite (Au NPs / HOFs) as a substrate were prepared. Based on this sandwich sensor, the sensor quantitatively measures cTnI antigen concentration in real serum samples using dual-mode (electrochemical and colorimetric) methods. This achieves visually interpretable, ultrasensitive dual-modal analysis, exhibiting high sensitivity and a low limit of detection, providing a novel approach for cTnI detection.

The devices and methods of the present invention can be used to capture and remove COVID-19 mediating nanoparticles and / or exosomes associated with COVID-19 or similar disease from the circulatory system of patients in need thereof, including those with post-COVID-19 syndrome or similar post-disease sequelae so-called “long haul” symptoms of COVID-19 or similar disease. The present invention benefits patients by providing lectin based extracorporeal methods for binding and physically removing SARS-C7oV-2 virions, or fragments thereof, from the circulatory system. Also provided are lectin based extracorporeal methods of binding and physically removing non-viral COVID-19 mediating nanoparticles. Also disclosed herein are devices and methods for reducing the levels of biomarkers and markers of morbidity / mortality of diseases such as COVID-19 and similar diseases, including cytokines, such as IL-6, Troponin T, and D-dimer.

The present invention relates to a method for assessing asymptomatic heart failure said method comprising cMyBP-C (Myosin binding protein C, cardiac type), and optionally the level of at least one further biomarker selected from the group consisting of MyL7 (Myosin light chain 7), at least one cardiac Troponin, Angiopoietin-2 (Ang-2), and at least one BNP -type peptide in a sample from the subject. The present invention further relates to computer-implemented methods, databases, devices, kits and uses related thereto.

The present application relates to the technical field of immunology and meat product adulteration meat source identification, and provides a hybridoma cell strain, an anti-fox skeletal muscle troponin monoclonal antibody produced by the hybridoma cell strain and application of the antibody, the preservation name of the hybridoma cell strain is: the hybridoma cell strain skTn-3A4 of the anti-fox skeletal muscle troponin monoclonal antibody, the preservation place is China Center for Type Culture Collection, the preservation date is October 10, 2023, and the preservation number is CCTCC NO: C2023302.The anti-fox skeletal muscle troponin monoclonal antibody skTn-3A4 provided by the present application can be used for preparing an enzyme-linked immunoassay kit, a colloidal gold chromatography test strip and an evanescent wave fluorescence immune sensor for detecting fox skeletal muscle troponin, so that the fox skeletal muscle troponin in food can be rapidly and sensitively detected.