Vector for editing nicotiana benthamiana gene based on CRISPR/Cas9 as well as construction method and application thereof
A construction method and technology of Nicotiana benthamiana, applied in the field of genetic engineering, can solve problems such as unsatisfactory effect, unstable disease resistance effect, environmental pollution by chemical reagents, and biological safety.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0051] Such as figure 1 Shown, a vector BKG-g10, BKG-g11 based on the CRISPR / Cas9 system targeting and editing the N. benthamiana UbEF1B gene to inhibit TLCYnV infection, and a vector targeting and editing the CCR4 / NOT gene of N. benthamiana to inhibit TLCYnV infection BKG-g12, BKG-g13.
[0052] Its construction method specifically includes the following steps:
[0053] (1) if figure 2 As shown, the PAM site was selected in the CDS region sequence of Nicotiana benthamiana UbEF1B gene and gRNA was designed; four gRNA strands including two targets required by BKG-g10 and BKG-g11 vectors respectively: g10-A / B, g11-A / B; as shown in SEQ ID: NO.1-NO.4;
[0054] g10-A:TGATTGCTGGTCTGCCGTACATCGG
[0055] g10-B:AAACCCGATGTACGGCAGACCAGCA
[0056] g11-A:TGATTGGATGTGGAGCGCCGGTTGC
[0057] g11-B:AAACGCAACCGGCGCTCCACATCCA
[0058] (2) Synthesize the single-stranded gRNA described in (1) into double-stranded, the specific method is as follows:
[0059] ① Dilute the above single-stran...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com