Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vector for editing nicotiana benthamiana gene based on CRISPR/Cas9 as well as construction method and application thereof

A construction method and technology of Nicotiana benthamiana, applied in the field of genetic engineering, can solve problems such as unsatisfactory effect, unstable disease resistance effect, environmental pollution by chemical reagents, and biological safety.

Pending Publication Date: 2020-04-21
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] (3) Geminiviruses mostly rely on insect vectors for transmission, and the use of a large number of chemical reagents seriously pollutes the environment and biological safety;
[0008] (4) At present, most of the vectors that use the endogenous gene of Nicotiana benthamiana for anti-virus research have unstable disease resistance or affect the original phenotype of the host plant, and the effect is not ideal

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector for editing nicotiana benthamiana gene based on CRISPR/Cas9 as well as construction method and application thereof
  • Vector for editing nicotiana benthamiana gene based on CRISPR/Cas9 as well as construction method and application thereof
  • Vector for editing nicotiana benthamiana gene based on CRISPR/Cas9 as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0051] Such as figure 1 Shown, a vector BKG-g10, BKG-g11 based on the CRISPR / Cas9 system targeting and editing the N. benthamiana UbEF1B gene to inhibit TLCYnV infection, and a vector targeting and editing the CCR4 / NOT gene of N. benthamiana to inhibit TLCYnV infection BKG-g12, BKG-g13.

[0052] Its construction method specifically includes the following steps:

[0053] (1) if figure 2 As shown, the PAM site was selected in the CDS region sequence of Nicotiana benthamiana UbEF1B gene and gRNA was designed; four gRNA strands including two targets required by BKG-g10 and BKG-g11 vectors respectively: g10-A / B, g11-A / B; as shown in SEQ ID: NO.1-NO.4;

[0054] g10-A:TGATTGCTGGTCTGCCGTACATCGG

[0055] g10-B:AAACCCGATGTACGGCAGACCAGCA

[0056] g11-A:TGATTGGATGTGGAGCGCCGGTTGC

[0057] g11-B:AAACGCAACCGGCGCTCCACATCCA

[0058] (2) Synthesize the single-stranded gRNA described in (1) into double-stranded, the specific method is as follows:

[0059] ① Dilute the above single-stran...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a vector for editing a nicotiana benthamiana gene based on CRISPR / Cas9 as well as a construction method and application thereof. The vector comprises a BKG-g10 vector and a BKG-g11 vector which are constructed by aiming at a nicotiana benthamiana UbEF1B gene, and / or a BKG-g12 vector and a BKG-g13 vector which are constructed by aiming at a nicotiana benthamiana CCR4 / NOT gene. According to the vector, after the UbEF1B gene or the CCR4 / NOT gene is edited, the growth state of nicotiana benthamiana is normal, and the phenotype is not obviously changed compared with that ofa wild type; and no influence is caused on the character, and progeny continuation is facilitated. Compared with the traditional breeding method, the method for editing a nicotiana benthamiana endogenous gene by virtue of a CRISPR / Cas9 system has the advantage that a disease-resistant material can be obtained more quickly and effectively.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a vector for editing Nicotiana benthamiana gene based on CRISPR / Cas9, its construction method and application. Background technique [0002] Tomato leaf curl Yunnan virus (TLCYnV) is mainly transmitted by Bemisia tabaci. Infected plants grow slowly, with leaves chlorotic and distorted. The damage can lead to yield reduction in mild cases, or failure in severe cases. At present, the disease caused by the virus has caused serious damage to many crops due to the difficulty in controlling it. In addition to the prevention-based control measures, more effective control measures are needed, such as the selection of disease-resistant varieties. and planting. [0003] At this stage, although some endogenous genes related to geminiviruses have been identified in host plants, their further application value in agricultural production and life has not yet been improved. Moreov...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/113C12N15/66A01H5/00A01H6/82
CPCC12N15/8218C12N15/8283C12N15/113C12N15/66C12N2310/20
Inventor 周雪平李方方李浩曹步暐
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com