Application of SNHG17 in screening drugs for regulating radiation-induced pulmonary epithelial cell mesenchymal transformation and/or pulmonary fibrosis

A technology for pulmonary epithelial cells and pulmonary fibrosis, applied in drug combinations, biochemical equipment and methods, pharmaceutical formulations, etc., can solve problems such as ineffective prevention and treatment methods, and unclear development mechanisms of radiation-induced pulmonary fibrosis. To achieve the effect of increasing sensitivity

Active Publication Date: 2020-04-24
ACADEMY OF MILITARY MEDICAL SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no report on the related research of SNHG17 participating in the regulation of radiation-induced pulmonary epithelial cell-to-mesenchymal transition and pulmonary fibrosis. The mechanism of the occurrence and development of radiation-induced pulmonary fibrosis is still unclear. Research hotspots and difficult problems to be solved in the medical field for a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of SNHG17 in screening drugs for regulating radiation-induced pulmonary epithelial cell mesenchymal transformation and/or pulmonary fibrosis
  • Application of SNHG17 in screening drugs for regulating radiation-induced pulmonary epithelial cell mesenchymal transformation and/or pulmonary fibrosis
  • Application of SNHG17 in screening drugs for regulating radiation-induced pulmonary epithelial cell mesenchymal transformation and/or pulmonary fibrosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0052] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solution of the present invention is described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.

[0053] In the embodiment of the present invention, the relevant sequence is as follows:

[0054] (1) The nucleotide sequence of SNHG17 is as follows:

[0055] SEQ ID NO: 1:

[0056] GTATTTCCGCCGGCGCGAAACGAGCGTAGCTTCCTTGTCGTGTGGCCTCAG TCCTTCGCCGTCCCTCGCCGTCCTTCGCCATCGCACGCCACCGCACCCCATCTCT CGAAATCTGCAGACATCTTGATTTTTCCCACGCTGTCTGTCAGGTCTCCGCCGCC ACTCGACGCCAGGGCGCCGGGCCTTGTGGGCTGTGCTGCACCTCGGACGGCTT CGCACCAGCCAGCGCCCTCTCTCTCCTGCAGCACTCTGATCTGCACCCCCTGAG GGGCTTCCACTGTCCGCGGGGTGAGAATGCCCCTGGGAGTGTCACATGACTGC CGCCCCATGTGTGTGAGAGGCGTCCTCTGGGAGAGCATGGATCCTGAGGTCCCA GGATTGTCAGCTGACCTCTGTCCTGTGTGCCCAGTGGCCCCAGGTGACGTGTCT TCAAGAAGAGGCTGAGCTGCGGTGCTTGTAAGGCAGGGTCTCATTCTGTCACC CAGGCTGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of SNHG17 in screening drugs for regulating radiation-induced pulmonary epithelial cell mesenchymal transformation and / or pulmonary fibrosis. SNHG17 can be used as apotential target for the prevention and treatment of radiation-induced pulmonary fibrosis. When the expression of SNHG17 is increased, radiation-induced pulmonary epithelial cell mesenchymal transformation is promoted. When the expression is decreases, radiation-induced pulmonary epithelial cell mesenchymal transformation is inhibited. The SNHG17 can be applied to promote the development of new drugs related to SNHG17 for the prevention and treatment of pulmonary fibrosis, and finally the drugs are applied to clinical tumor treatment to improve the sensitivity of tumor patients to radiotherapy and achieve true accurate radiotherapy in clinic.

Description

technical field [0001] The invention belongs to the technical field of radioactive pulmonary fibrosis treatment, and relates to an application of SNHG17 in screening drugs for regulating radiation-induced pulmonary epithelial cell-to-mesenchymal transition and / or pulmonary fibrosis. Background technique [0002] Radiation therapy using radiation to kill tumor cells is one of the common methods for clinical treatment of malignant tumors. Nearly 70% of malignant tumor patients need radiation therapy. Radiation-induced pulmonary fibrosis (RIPF) is a common complication of radiotherapy in patients with thoracic tumors. Once radiation-induced pulmonary fibrosis occurs, it is difficult to reverse, which not only limits the effective application of radiotherapy, but also causes lung failure and even death in cancer patients due to the prolonged development of pulmonary fibrosis. Although many years of research on radiation-induced pulmonary fibrosis have been carried out at home a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6886A61K45/00A61K31/713A61P11/00
CPCC12Q1/6886A61K45/00A61K31/713A61P11/00C12Q2600/178C12Q2600/136
Inventor周平坤黄瑞雪刘晓丹胡赛周瑶
OwnerACADEMY OF MILITARY MEDICAL SCI