An epigenetic dap-seq sequencing library construction method
An epigenetic and dap-seq technology, applied in the field of high-throughput sequencing library construction, can solve problems such as the difficulty of transgenic experiments, the difference in CHIP-seq effects, and the destruction of original genome DNA modification information, etc., to achieve a large-scale implementation Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0060] Embodiment A kind of epigenetic DAP-seq sequencing library construction method
[0061] The method for building a library by DAP-seq sequencing of the epigenetics comprises the steps of:
[0062] S1. Construction of gene expression vector:
[0063] (1) Taking the R2R3-MYB transcription factor as an example, the full length of its CDS sequence is as described in SEQ ID NO.3. According to the instructions of the infusion kit, the primers for the synthesis of the R2R3-MYB transcription factor were designed to obtain TF primers, and the primers were underlined The sequence is the terminal homologous recombination sequence on the vector; wherein, the upstream primer of the TF primer is TF-F, and the primer sequence is as shown in SEQ ID NO.4, and the downstream primer is TF-R, and the primer sequence is as in SEQ ID NO.5 shown;
[0064] ATGAAAGGGGTTCGTTTAGGA ATGAGAAAGGGTGCTTGGACTCGGGAAGAAGATCTCCTTCTTAGGAACTGCATTCAAAAGTATGGAGAAGGAGTTTGGCACCAAGTTCCTTCAGAGCAGGCTTGAACAGATGTA...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com