Unlock instant, AI-driven research and patent intelligence for your innovation.

Epigenetic DAP-seq sequencing library building method

An epigenetic and dap-seq technology, applied in the field of high-throughput sequencing library construction, can solve the problems of difficult transgenic experiments, difficult to restore TF, long cycle, etc., and achieve the effect of facilitating large-scale development

Active Publication Date: 2020-05-15
GUANGZHOU GENE DENOVO BIOTECH
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This scheme still has a shortcoming: for some species, the transgenic experiment is very difficult or the cycle is very long, and the experimental threshold is still very high
The biggest shortcoming of this method is that the DNA is artificially synthesized, and there is no modification information (such as DNA methylation) on the original genomic DNA
However, information such as DNA methylation is an important factor affecting TF binding, so methods such as SELEX and PBM are difficult to restore the real binding situation of TF in vivo, and there is still a big difference in the effect of CHIP-seq.
[0005] It can be seen that the existing technology generally has the disadvantages of poor effect, destroying the modification information on the original genomic DNA, and making it difficult to restore the real situation of TF in vivo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Epigenetic DAP-seq sequencing library building method
  • Epigenetic DAP-seq sequencing library building method
  • Epigenetic DAP-seq sequencing library building method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0060] Embodiment A kind of epigenetic DAP-seq sequencing library construction method

[0061] The method for building a library by DAP-seq sequencing of the epigenetics comprises the steps of:

[0062] S1. Construction of gene expression vector:

[0063] (1) Taking the R2R3-MYB transcription factor as an example, the full length of its CDS sequence is as described in SEQ ID NO.3. According to the instructions of the infusion kit, the primers for the synthesis of the R2R3-MYB transcription factor were designed to obtain TF primers, and the primers were underlined The sequence is the terminal homologous recombination sequence on the vector; wherein, the upstream primer of the TF primer is TF-F, and the primer sequence is as shown in SEQ ID NO.4, and the downstream primer is TF-R, and the primer sequence is as in SEQ ID NO.5 shown;

[0064] ATGAAAGGGGTTCGTTTAGGA ATGAGAAAGGGTGCTTGGACTCGGGAAGAAGATCTCCTTCTTAGGAACTGCATTCAAAAGTATGGAGAAGGAGTTTGGCACCAAGTTCCTTCAGAGCAGGCTTGAACAGATGTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of high-throughput sequencing library building, and particularly relates to an epigenetic DAP-seq sequencing library building method. The sequencing library buildingmethod provided by the invention mainly comprises the processes of vector building, TF in-vitro expression pre-experiment, DAP-seq library building and the like. According to the sequencing library building method provided by the invention, the genome DNA extracted from cells can be directly combined with target TF, so that genome DNA modification can be reserved, and compared with the prior art,the sequencing library building method is closer to an in-vivo test.

Description

technical field [0001] The invention belongs to high-throughput sequencing library construction technology, in particular to an epigenetic DAP-seq sequencing library construction method. Background technique [0002] In epigenetics research, the discovery of transcription factor (TF, Transcription factors) binding sites has always been a difficult problem, and CHIP-seq is the most effective technique to directly study the target TF binding site. CHIP-seq uses specific TF antibodies to pull out the DNA fragments that bind to TF through co-immunoprecipitation, and then through high-throughput sequencing, it can directly detect the binding sites of specific TFs on the genome and analyze the binding sites. motif (signature sequence of binding site). [0003] However, CHIP-seq is not applicable to all species, and there are mainly the following difficulties: (1) Difficulties in antibody preparation: For popular transcription factors in common model species such as humans and mic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C40B50/06C12N15/70
CPCC12N15/70C40B50/06
Inventor 周煌凯夏昊强高川艾鹏陈飞钦张东东张秋雪
Owner GUANGZHOU GENE DENOVO BIOTECH