Application of bpvnd1 gene
A technology of gene and gene expression, applied in the field of birch cultivation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Production of birch transgenic plants:
[0037] Vector construction: select a 256bp sequence (SEQ ID NO.3) in the coding region of the BpVND1 gene:
[0038] GTTCAGCTTCCTCAACTAGAGAGCCCATCTCTGCCGTTAATAAAGAGGCCGCCAAGCTCAATATCTCTGATATCAGAAAATAATGAAGAAGAAGAGCAAATTATGAATAGAGGGTGCAAACAACCCAGAAAGTGACTGATTGGAGGGCCCTTGACAAGTTTGTTGCTTCTCAATTGAGTCAAGAAGATAGATTTGAGGGTGATGGAGAATCAAGCTTTGGCGACCACACAGGG.
[0039] Respectively introduce restriction sites to design primers to amplify the forward and reverse sequences, and then insert these two sequences into the pFGC5941 vector respectively to construct the RNAi vector pFGC5941-ProBpVND1 of the BpVND1 gene.
[0040] Table 1 Primers used in the construction of pFGC5941-ProBpVND1 vector
[0041]
[0042] Birch transgene: the constructed RNAi vector was transferred into the birch genome by Agrobacterium-mediated leaf disc transformation. The specific method is as follows: activate the Agrobacterium strain of the RNAi carrier, shake the...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap