Supercharge Your Innovation With Domain-Expert AI Agents!

1ncRNA SFR1 as well as application thereof and product and method for regulating and controlling follicular development

A technology of follicle development and products, which is applied in the field of products regulating follicle development, and can solve problems such as low fecundity and impact

Inactive Publication Date: 2020-07-07
JILIN ACAD OF AGRI SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, other excellent local sheep breed resources with the characteristics of delicious meat and excellent coat quality have been greatly impacted due to their relatively low fecundity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 1ncRNA SFR1 as well as application thereof and product and method for regulating and controlling follicular development
  • 1ncRNA SFR1 as well as application thereof and product and method for regulating and controlling follicular development
  • 1ncRNA SFR1 as well as application thereof and product and method for regulating and controlling follicular development

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Example 1 Location of lncRNA SFR1

[0078] During the screening of differentially expressed genes with different litter sizes, the inventors detected a new differentially expressed lncRNA (MSTRG.28645), and named it SFR1 (Sheep Fedunty Related LncRNA1, SFR1).

[0079] SFR1 was used in cpc( http: / / nar.oxfordjournals.org / content / 35 / suppl_2 / W345.full ) software and cnci ( https: / / github.com / www-bioinfo-org / CNCI ) lncRNA predicted by the software for the first time. After working with Ovis aries4.0( https: / / www.ncbi.nlm.nih.gov / genome / 83?hl=en genome_assembly_id=259810 ) comparison of the reference genome, it was found that it is located on chromosome 6 of sheep, and its position on the comparison is 66449727-66452013.

[0080] In order to determine whether the newly predicted lncRNA SFR1 is expressed in sheep granulosa cells, qRT-PCR primers for SFR1 (Forward: AGTCATT CCAAACTTCATCCTCC; Reverse: GGGACACTCTTCCGACTATTACAA) were designed based on the sequence inform...

Embodiment 2

[0081] Example 2 Overexpression of lncRNA SFR1

[0082] Firstly, the full-length 2,791bp cDNA sequence of sheep lncRNA SFR1 was cloned, and then the eukaryotic expression vector of sheep SFR1: pIRES2-ZsGreen1-SFR1 was constructed, and its function was verified by transient transfection in sheep ovary granulosa cells. The relative expression of SFR1 was 150.88±13.13%, as figure 2 shown. Among them, "control" represents the untreated control group; "SFR1" represents the SFR1 expression-treated or interfered-treated group. "OE" represents the SFR1 overexpression treatment group; "siRNA-1" represents the SFR1 siRNA-1 treatment group; "siRNA-2" represents the SFR1 siRNA-2 treatment group; "siRNA-3" represents the SFR1 siRNA-3 treatment group. Data are expressed as mean ± SEM, and statistical analysis was performed using t-test. * means significant difference, p<0.05.

Embodiment 3

[0083] Example 3 siRNA interference of lncRNA SFR1

[0084] In order to achieve a better siRNA interference effect, three pairs of interference fragments were first designed for sheep SFR1 (siRNA1 (1987): CCGAAUUCCUGACAUAUAUTT AUAUAU GUCAGGAAUUCGGTT; siRNA2 (2498): CCGCAAUAUGUAAGACAAA TT UUUGUCUUACAUAUUGCGGTT; siRNA3 (2279): GGACACCUACAGAGACUUGAATGAGU) figure 2 As shown, the expression levels of SFR1 relative to the blank group were 94.94 ± 12.20%, 89.48 ± 4.19% and 33.32 ± 1.29% respectively after the interference of 3 pairs of interference fragments. Therefore, the third pair of interference fragments (SEQ ID NO.2 and SEQ ID NO.2 and SEQ ID NO. .3) Perform subsequent cell transfection experiments.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides 1ncRNA SFR1 as well as application thereof and a product and a method for regulating and controlling follicular development and relates to the technical field of biologics. Theinvention provides novel long-chain non-encoding RNA SFR1, wherein the 1ncRNA SFR1 is related to apoptosis of granular cells, and by regulating and controlling expression of 1ncRNA SFR1, correspondingregulation and control functions on channels, genes and hormones related to follicular development can be also achieved. Therefore, by adopting the 1ncRNA SFR1 and a corresponding product provided bythe invention, effective in-vivo / in-vitro regulation and control on follicular development can be achieved, and powerful guarantee can be provided for research on follicular development and physiology and biochemical functions. In addition, through the regulation and control functions of the 1ncRNA SFR1 on follicular development, the population fertility can be improved while excellent propertiesof genetic resources of mammals, particularly sheep, are maintained, and thus the economic benefits of breeding can be increased.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to lncRNA SFR1 and its application, products and methods for regulating follicle development. Background technique [0002] China's sheep raising industry has a long history, which can be traced back to the Xia and Shang Dynasties. Up to now, sheep farming is still one of the main pillar industries of animal husbandry in my country's vast agricultural and pastoral areas. In 2017, the annual stock of sheep alone was 160 million. In order to pursue higher production efficiency, farmers pay more attention to the added output value brought by sheep breeds. Hybridization and improvement of original local resources through fine varieties is the best choice to quickly improve the production efficiency of sheep breeding. [0003] In crossbreeding, small-tailed Han sheep and Hu sheep with high fecundity characteristics stand out among local fine breeds in my country and become the main force o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12Q1/6888C12N5/10
CPCC12N5/0609C12N15/113C12N2310/10C12N2510/00C12Q1/6888C12Q2600/158C12Q2600/178
Inventor 王春昕张明新赵云辉翟博苑志宇赵卓徐菁吴翠玲
Owner JILIN ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More