Check patentability & draft patents in minutes with Patsnap Eureka AI!

An isolated Lygus taiman gene and its encoded protein

A technology of Lygus chinensis and genes, which can be applied in genetic engineering, plant genetic improvement, peptide source, etc., can solve the problems of increased resistance of pests

Active Publication Date: 2021-07-20
HUAZHONG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The increasing use of chemical pesticides has led to the enhancement of pest resistance, and it is imminent to find scientific and environmentally friendly insecticide strategies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An isolated Lygus taiman gene and its encoded protein
  • An isolated Lygus taiman gene and its encoded protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Cloning and analysis of the Lygus chinensis Taiman gene

[0026] Lygus stinkbug RNA was extracted by TRIzol method, and the extracted total RNA was synthesized into a cDNA template using the RTMasterMix (perfect realtime) kit (specific steps follow the kit instructions). The primer sequences were designed as follows.

[0027] Upstream primer sequence TAI-F: 5'-CGCTTATGCAATGCGAGACG-3',

[0028] Downstream primer sequence TAI-R: 5'-GCCAGTGAGCTGGGCATTGA-3'.

[0029] Using the cDNA of Lygus melanogaster as a template, PCR amplification was carried out using the above primers TAI-F and TAI-R. The recovered PCR product was ligated with the pEASY-T1 vector, the recombinant vector was transformed into competent cells T1, and the ampicillin-resistant LB medium was cultured overnight. After culturing overnight, 8 positive clones were picked for PCR verification, and colony PCR amplified as positive clones were sent for sequencing with fresh bacterial liquid.

[003...

Embodiment 2

[0031] Example 2: Synthetic dsRNA

[0032] According to the Taiman gene sequence that obtains in embodiment 1, design specific amplification primer (5'-end adds T7

[0033] promoter sequence), for the amplification of the dsRNA fragment of Taiman gene, the specific primer of design is as follows:

[0034] Upstream primer sequence dsTAI-F: GCACAGTACAACCTTGGACC,

[0035] Downstream primer sequence dsTAI-R: GTTGAACCTCCACTCCCTCC.

[0036] Using the cDNA of Lygus melanogaster as a template, the above-mentioned primers dsTAI-F and dsTAI-R were used for PCR amplification, and the PCR product was connected to the pEASY-T1 vector. Pick a single colony that is positive in the colony PCR test, send it for sequencing, and check the correctness of the gene sequence. For the single colony with correct sequencing, 6ml LB+AMP medium was shaken overnight.

[0037] Extract the plasmid containing the target fragment, use the plasmid as a template, and use the above-mentioned specific primers ...

Embodiment 3

[0039] Example 3 The silencing efficiency of the gene after injection of Taiman gene dsRNA and its effect on the number and fecundity of eggs in the female ovary

[0040] Using the double-stranded dsRNA of the green fluorescent protein gene (GFP) as a control, the dsRNA of the Taiman gene was injected into the newly eclovened females through the microinjection method from the outermost side of the hind thorax and abdominal intersegmental membrane of Lygus chinensis.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention relates to the technical field of insect genetic engineering. In particular, it relates to an isolated Taiman gene of Lygus melanogaster and its encoded protein. The nucleotide sequence of the gene is shown in SEQ ID No:1. The dsRNA of the Taiman gene of the present invention is microinjected into the body of the first-emergent females of Lygus medaka, and it is found that the expression of the Taiman gene is extremely significantly suppressed throughout the growth period, and the suppression of the expression of the Taiman gene significantly reduces the melanocystis. The number of eggs in the ovary of the stink bug and the lifetime egg production of Lygus mesophila ultimately affect the reproductive ability and population development of Lygus mesophila. Taiman gene can be used as an alternative gene for the cultivation of transgenic plants resistant to Lygus spp.

Description

technical field [0001] The invention relates to the technical field of insect genetic engineering. Specifically, it relates to an isolated Lygus chinensis Taiman gene and its encoded protein. Background technique [0002] Adelphocorissutures (Adelphocorissutures) belongs to the genus Adelphocorissutures of the family Miridae of Hemiptera. It is a highly omnivorous pest and is widely distributed in Japan, China, Korea and the former Soviet Union. The host range of Adelphocorissutures is very wide. It mainly harms cotton, soybeans, alfalfa, etc. Since the commercial planting of transgenic Bt cotton in 1997, the harm of the target Lepidoptera pests has been well controlled, but the non-target pests of the black Lygus have gradually risen from the secondary pests to the main ones. Pests, and showed a trend of further spread and large-scale catastrophe. At present, the control of Miridae pests is mainly based on chemical control. Because the harm of Lygus melanogaster is relati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/63C12N15/82A01H5/00A01H6/00
CPCC07K14/43563C12N15/8286
Inventor 陈利珍薛汇黄星星任俊张航
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More