Construction method and application of recombinant bacteria producing canine alpha-interferon
A construction method and interferon technology, applied in the field of recombinant bacteria construction, can solve the problems of low specific activity and low expression rate of interferon alpha, and achieve the effect of promoting soluble expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1. Construction of recombinant expression vector pET-CaIFN-α
[0043] 1. Alpha-interferon gene synthesis and modification
[0044](1) Referring to the canine α-interferon gene sequence (Genbank accession number: NP_001006655.1), the 31st base of the α-interferon gene sequence was changed from C to T, and NdeI was added at the 5' end to cut The CATATG site was added to the 3' end (TGT), and the XhoI restriction site CTCGAG was added, and sent to Beijing Nuosai Genome Research Center Co., Ltd. for total gene synthesis. The gene sequence of the modified alpha-interferon is shown in SEQ ID NO: 1. The amino acid sequence of the modified alpha-interferon is shown in SEQ ID NO:2.
[0045] (2) Design the gene primers of canine α-interferon: design primers according to the above-mentioned canine α-interferon gene sequence, the 5' end of the upstream primer introduces NdeI restriction site CATATG, and the 3' end of the downstream primer introduces XhoI restriction site ...
Embodiment 2
[0054] Example 2. Recombinant expression vector pET-ACP-CaIFN-α
[0055] (1) ACP gene synthesis: Referring to the ACP gene sequence (GenBank accession number: NC_000913, 1151614..1151845nt), a TEV protease recognition site (GAAAATCTTTACTTTCAAGGAGGA) and two glycines (GGAGGA) were introduced at the 3' end of ACP, and two glycines (GGAGGA) were introduced at the 3' end of ACP. The XhoI restriction site CTCGAG was added to the end for ACP gene synthesis. The nucleotide sequence of the ACP gene is shown in SEQ ID NO:5. Table 2 shows the synthetic ACP primer sequences, as shown in SEQ ID NO:6 and SEQ ID NO:7.
[0056] Table 2
[0057]
[0058] (2) ACP gene digestion: The synthesized ACP gene was digested with restriction endonuclease Xho I, and the digestion system (20 μl): ACP gene 1 μl, Xho I 1 μl, 10×Buffer 2 μl, ddH 2 O 16μl, operate on ice, mix and digest at 37°C for 2h.
[0059] (3) Recombinant plasmid pET-CaIFN-α was digested: The pET-CaIFN-α plasmid was digested with...
Embodiment 3
[0064] Example 3. Construction of recombinant expression vector pET-ACP-CaIFN-α-MBP
[0065] (1) MBP gene synthesis reference pAB-MBP TM Sequence, introduced Factor Xa specific recognition site (ATTGAAGGAAGA) at the 5' end, and added NdeI restriction site CATATG at both ends, and synthesized the MBP gene primer sequence as shown in Table 3 below. SEQ ID NO: 8 and SEQ ID NO: 9 are shown.
[0066] table 3
[0067]
[0068] (2) MBP gene digestion: The synthesized MBP gene was digested with the restriction enzyme NdeI, and the digestion system (20 μl): 1 μl of MBP gene, 1 μl of NdeI, 2 μl of 10×Buffer, 16 μl of ddH2O, operated on ice, After mixing, the enzyme was digested at 37°C for 2h.
[0069] (3) Recombinant plasmid pET-ACP-CaIFN-α digestion: double digestion of pET-ACP-CaIFN-α plasmid with restriction enzyme NdeI, digestion system (20 μl): pET-ACP-CaIFN-α plasmid 1μl, NdeI 1μl, 10×Buffer 2μl, ddH 2 O16μl, operated on ice, mixed and digested at 37°C for 2h.
[0070] (...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More