Construction method and application of recombinant bacterium producing canine interferon- alpha
A construction method and technology of interferon, applied in the field of construction of recombinant bacteria, can solve the problems of low expression rate and low specific activity of alpha interferon
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1, Construction of recombinant expression vector pET-CaIFN-α
[0043] 1. Synthesis and modification of α-interferon gene
[0044](1) Referring to the canine α-interferon gene sequence (Genbank accession number: NP_001006655.1), change the 31st base of the α-interferon gene sequence from C to T, and add NdeI digestion at the 5' end The site CATATG, the 3' end was added (TGT), and the XhoI restriction site CTCGAG was added, and sent to Beijing Nuosai Genome Research Center Co., Ltd. for whole gene synthesis. The gene sequence of the modified α-interferon is shown in SEQ ID NO:1. The amino acid sequence of the modified α-interferon is shown in SEQ ID NO:2.
[0045] (2) Design the gene primers of canine α-interferon: design primers according to the above canine α-interferon gene sequence, introduce the NdeI restriction site CATATG at the 5' end of the upstream primer, and introduce the XhoI restriction site CTCGAG at the 3' end of the downstream primer , under th...
Embodiment 2
[0054] Example 2, recombinant expression vector pET-ACP-CaIFN-α
[0055] (1) ACP gene synthesis: referring to the ACP gene sequence (GenBank accession numbers: NC_000913, 1151614..1151845nt), a TEV protease recognition site (GAAAATCTTTACTTTCAAGGAGGA) and two glycines (GGAGGA) were introduced at the 3' end of ACP, and Add the XhoI restriction site CTCGAG to the end for ACP gene synthesis. The nucleotide sequence of the ACP gene is shown in SEQ ID NO:5. Table 2 is the sequence of synthetic ACP primers, as shown in SEQ ID NO:6 and SEQ ID NO:7.
[0056] Table 2
[0057]
[0058] (2) ACP gene digestion: Digest the synthesized ACP gene with restriction endonuclease Xho I, enzyme digestion system (20 μl): ACP gene 1 μl, Xho I 1 μl, 10×Buffer 2 μl, ddH 2 O 16μl, operate on ice, mix and digest at 37°C for 2h.
[0059] (3) Digestion of recombinant plasmid pET-CaIFN-α: Digest pET-CaIFN-α plasmid with restriction endonuclease Xho I, enzyme digestion system (20 μl): pET-CaIFN-α plas...
Embodiment 3
[0064] Example 3, Construction of recombinant expression vector pET-ACP-CaIFN-α-MBP
[0065] (1) MBP gene synthesis refers to pAB-MBP TM Sequence, Factor Xa-specific recognition site (ATTGAAGGAAGA) was introduced at the 5' end, and NdeI restriction site CATATG was added at both ends, and the MBP gene primer sequence was synthesized as shown in Table 3. Shown in SEQ ID NO:8 and SEQ ID NO:9.
[0066] table 3
[0067]
[0068] (2) Digestion of MBP gene: digest the synthesized MBP gene with restriction endonuclease NdeI, digestion system (20 μl): 1 μl of MBP gene, 1 μl of NdeI, 2 μl of 10×Buffer, 16 μl of ddH2O, operate on ice, After mixing, digest at 37°C for 2 hours.
[0069] (3) Digestion of recombinant plasmid pET-ACP-CaIFN-α: double digestion of pET-ACP-CaIFN-α plasmid with restriction endonuclease NdeI, enzyme digestion system (20μl): pET-ACP-CaIFN-α plasmid 1μl, NdeI 1μl, 10×Buffer 2μl, ddH 2 O16μl, operate on ice, mix and digest at 37°C for 2h.
[0070] (4) Connec...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More