Preparation method of mouse model for specific expression of Cre enzymes in gastric epithelial cells
A technology of epithelial cells and mouse models, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, isomerases, etc., can solve the problem of low efficiency of target gene editing, Cre enzyme expression abundance and low stability , Gastric tissue expression cells are not completely consistent with disease origin cells, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0014] The invention provides a method for preparing a mouse model expressing Cre enzyme specifically in gastric mucosal epithelial cells, comprising the following steps: connecting the Cre-2A sequence at the 5' section of the mouse Tff1 gene initiation codon; the Cre- The 2A sequence is shown in SEQID NO.1.
[0015] The present invention preferably inserts the Cre-2A sequence into the upstream of the mouse Tff1 gene initiation codon, and is close to the initiation codon ATG, and the insertion method preferably includes the CRISPR-Pro gene site-directed knock-in method. The specific method of the CRISPR-Pro gene site-specific knock-in method is not particularly limited in the present invention, and the conventional CRISPR-Pro gene site-specific knock-in method technical process in the field can be used. In the present invention, the Cre-2A sequence is inserted into the upstream of the start codon of the mouse Tff1 gene, and it is close to the start codon ATG, so that the Cre-2...
Embodiment 1
[0021] 1. CRISPR vector construction
[0022] 1) Synthesize gRNA primers and anneal the primers
[0023] gRNA (matching the reverse strand of the Tff1 gene, SEQ ID NO.5): GTGCTCCATGGCAGCTTCACGGG;
[0024] The specific system and procedure of annealing are as follows:
[0025] Primer sequence:
[0026] F (SEQ ID NO.6): 5'-CACCGGTGCTCCATGGCAGCTTCAC-3';
[0027] R (SEQ ID NO.7): 5'-AAACGTGAAGCTGCCATGGAGCACC-3';
[0028] Annealing system (10μL):
[0029]
[0030] Annealing PCR program: 37°C for 30 minutes, 95°C for 5 minutes, 95°C cooling down to 25°C at a rate of 5°C / min.
[0031] 2) The annealed product is ligated with the linearized pX330 base vector.
[0032] 3) The ligation product was transformed into competent cells, cultured on a plate overnight; a single colony was picked, and positive clones were screened by colony PCR; the identified positive clones were sequenced and verified; the sequence was correct, indicating that the CRISPR vector had been successfully co...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap