Check patentability & draft patents in minutes with Patsnap Eureka AI!

Preparation method of mouse model for specific expression of Cre enzymes in gastric epithelial cells

A technology of epithelial cells and mouse models, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, isomerases, etc., can solve the problem of low efficiency of target gene editing, Cre enzyme expression abundance and low stability , Gastric tissue expression cells are not completely consistent with disease origin cells, etc.

Active Publication Date: 2020-09-18
ZHONGSHAN HOSPITAL XIAMEN UNIV
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] The gastric tissue-specific Cre mouse model has always been an in vivo tool model that is urgently needed in the field of gastric-related disease research. Up to now, there is still no commercially available gastric tissue-specific Cre mouse model for scientific research in the world, and the existing The Cre mouse model that can be used for gastric disease-related research usually shows that other tissues and organs express Cre enzyme (such as Lgr5-Cre) at the same time as the stomach, and even have poor expression specificity, low abundance and stability of Cre enzyme expression, resulting in target gene The editing efficiency is low, and the gastric tissue expressing cells of Cre enzyme are not completely consistent with the disease origin cells, so it is difficult to simulate the real situation of the disease, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of mouse model for specific expression of Cre enzymes in gastric epithelial cells
  • Preparation method of mouse model for specific expression of Cre enzymes in gastric epithelial cells
  • Preparation method of mouse model for specific expression of Cre enzymes in gastric epithelial cells

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0014] The invention provides a method for preparing a mouse model expressing Cre enzyme specifically in gastric mucosal epithelial cells, comprising the following steps: connecting the Cre-2A sequence at the 5' section of the mouse Tff1 gene initiation codon; the Cre- The 2A sequence is shown in SEQID NO.1.

[0015] The present invention preferably inserts the Cre-2A sequence into the upstream of the mouse Tff1 gene initiation codon, and is close to the initiation codon ATG, and the insertion method preferably includes the CRISPR-Pro gene site-directed knock-in method. The specific method of the CRISPR-Pro gene site-specific knock-in method is not particularly limited in the present invention, and the conventional CRISPR-Pro gene site-specific knock-in method technical process in the field can be used. In the present invention, the Cre-2A sequence is inserted into the upstream of the start codon of the mouse Tff1 gene, and it is close to the start codon ATG, so that the Cre-2...

Embodiment 1

[0021] 1. CRISPR vector construction

[0022] 1) Synthesize gRNA primers and anneal the primers

[0023] gRNA (matching the reverse strand of the Tff1 gene, SEQ ID NO.5): GTGCTCCATGGCAGCTTCACGGG;

[0024] The specific system and procedure of annealing are as follows:

[0025] Primer sequence:

[0026] F (SEQ ID NO.6): 5'-CACCGGTGCTCCATGGCAGCTTCAC-3';

[0027] R (SEQ ID NO.7): 5'-AAACGTGAAGCTGCCATGGAGCACC-3';

[0028] Annealing system (10μL):

[0029]

[0030] Annealing PCR program: 37°C for 30 minutes, 95°C for 5 minutes, 95°C cooling down to 25°C at a rate of 5°C / min.

[0031] 2) The annealed product is ligated with the linearized pX330 base vector.

[0032] 3) The ligation product was transformed into competent cells, cultured on a plate overnight; a single colony was picked, and positive clones were screened by colony PCR; the identified positive clones were sequenced and verified; the sequence was correct, indicating that the CRISPR vector had been successfully co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of a mouse model for specific expression of Cre enzymes in gastric epithelial cells, and relates to the technical field of mouse models. A Cre-2A gene sequence is inserted to an upper stream of an initiation codon of a Tff1 gene, finally, specific expression of the Cre enzymes in the gastric epithelial cells is realized, the expression specificity of theCre enzymes by stomach tissue is better than that of a similar model which is reported at current, the gastric epithelial cells expressed by the Tff1 gene are consistent with an origin of the gastricepithelial cells, and the mouse model prepared by the preparation method can be used for research in the field of gastric cancer.

Description

technical field [0001] The invention belongs to the technical field of mouse models, and in particular relates to a method for preparing a mouse model in which gastric mucosal epithelial cells specifically express Cre enzyme. Background technique [0002] The gastric tissue-specific Cre mouse model has always been an in vivo tool model that is urgently needed in the field of gastric-related disease research. Up to now, there is still no commercially available gastric tissue-specific Cre mouse model for scientific research in the world, and the existing The Cre mouse model that can be used for gastric disease-related research usually shows that other tissues and organs express Cre enzyme (such as Lgr5-Cre) at the same time as the stomach, and even have poor expression specificity, low abundance and stability of Cre enzyme expression, resulting in target gene The editing efficiency is low, and the gastric tissue expression cells of Cre enzyme are not completely consistent with...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/90C12N15/62A01K67/027
CPCA01K67/0275A01K2217/072A01K2227/105A01K2267/03C07K2319/00C12N9/90C12N15/8509C12N15/907C12N2800/107C12Y599/01002
Inventor 蔡望宇蔡建春董紫南林凌云
Owner ZHONGSHAN HOSPITAL XIAMEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More