Unlock instant, AI-driven research and patent intelligence for your innovation.

WPRE mutant virus vector and application thereof

A viral vector and lentiviral vector technology, applied in the field of WPRE mutant viral vectors, can solve problems to be improved, and achieve the effects of large market economic value and simple construction method

Active Publication Date: 2020-10-02
OBIO TECH SHANGHAI CORP LTD
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the improvement level of the titer of the existing WPRE element to the lentiviral vector needs to be improved, and it is urgent to invent a new WPRE mutant to improve the titer level of the lentivirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • WPRE mutant virus vector and application thereof
  • WPRE mutant virus vector and application thereof
  • WPRE mutant virus vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] This embodiment constructs random mutation target fragments and screens out WPRE mutants with better effects, including:

[0049] 1.1 Preparation of target fragments for random mutation

[0050] 1.2 The mutation template sequence is as follows:

[0051]tcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggc(SEQ ID NO:4)

[0052] 1.3 Primer design:

[0053] F --- taaggatcctcaacctctggattacaaaatttgtgaaagattga (SEQ ID NO: 5)

[0054] R --- cactgcaggcccaaagggaga...

Embodiment 2

[0091] In this embodiment, the effective WPRE mutant is verified on the adeno-associated virus vector, as follows:

[0092] 1. Adeno-associated virus vector construction:

[0093] The WPRE mutant 03 sequence to detect the enhancement effect was constructed into an adeno-associated virus vector, in pAAV-CMV-EGFP-wtWPRE (see the map in Figure 6 ) based on pAAV-CMV-EGFP-WPRE mutant-03.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of viral vectors, and particularly relates to a WPRE mutant virus vector and application thereof. The WPRE mutant virus vector includes a WPRE mutant-03, and a nucleotide sequence of the WPRE mutant-03 is shown as SEQ ID NO:3. A construction method include the steps that S1, random mutation target fragments are prepared; S2, the random mutation target fragments are connected to a target vector that can express fluorescent protein; S3, after coating on plate is carried out, cells are screened by flow cytometer; S4, a cell genome obtained by screening is extracted, and a PCR technology is used to amplify a WPRE region; and S5, after a T vector is connected, coating on plate is carried out to obtain cloned cells, sequencing is carried out to obtain the WPREmutant virus vector. A WPRE random point mutation virus library is designed and constructed through a large amount of innovative work, and a novel WPRE mutant virus vector is found through library screening and has a significant promoting effect on virus packaging.

Description

technical field [0001] The invention belongs to the field of virus vectors, and in particular relates to a WPRE mutant virus vector and its application. Background technique [0002] WPRE (wood chuck hepatitis virus posttranscriptional regμlatory element) is the woodchuck hepatitis B virus post-transcriptional regulatory element, about 600 bp in length, belonging to the cis-acting element (DNA sequence), and composed of three parts: gamma, alpha, and beta. The main functions of WPRE are as follows: 1) Improve the packaging titer of the virus; 2) Help detect the titer of the virus; 3) At the same time, it effectively helps the polyA tailing efficiency of mRNA, and enhances the expression and stability of the transgene. Although the specific mechanism is still not very clear, WPRE elements are still widely used in various viral vectors. [0003] Lentivirus vector is a gene therapy vector developed on the basis of HIV-1 (human immunodeficiency virus type I). Different from ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N15/864C12N15/113C12N7/01C12N5/10
CPCC12N7/00C12N15/113C12N15/86C12N2740/15021C12N2740/15043C12N2750/14121C12N2750/14143C12N2830/48
Inventor 杨兴林贾国栋潘讴东杨佳丽马佩敏夏清梅
Owner OBIO TECH SHANGHAI CORP LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More