WPRE mutant virus vector and application thereof
A viral vector and lentiviral vector technology, applied in the field of WPRE mutant viral vectors, can solve problems to be improved, and achieve the effects of large market economic value and simple construction method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] This embodiment constructs random mutation target fragments and screens out WPRE mutants with better effects, including:
[0049] 1.1 Preparation of target fragments for random mutation
[0050] 1.2 The mutation template sequence is as follows:
[0051]tcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggc(SEQ ID NO:4)
[0052] 1.3 Primer design:
[0053] F --- taaggatcctcaacctctggattacaaaatttgtgaaagattga (SEQ ID NO: 5)
[0054] R --- cactgcaggcccaaagggaga...
Embodiment 2
[0091] In this embodiment, the effective WPRE mutant is verified on the adeno-associated virus vector, as follows:
[0092] 1. Adeno-associated virus vector construction:
[0093] The WPRE mutant 03 sequence to detect the enhancement effect was constructed into an adeno-associated virus vector, in pAAV-CMV-EGFP-wtWPRE (see the map in Figure 6 ) based on pAAV-CMV-EGFP-WPRE mutant-03.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com