Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular markers linked to qtl QTA-2B linked to tiller angle in wheat and its application

A molecular marker, wheat technology, applied in the field of molecular biology and crop genetics and breeding, can solve the problem of not many molecular markers, achieve accurate and efficient detection, high utilization value, and improve the efficiency of selection and identification

Active Publication Date: 2021-10-08
SICHUAN AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are not many tightly linked molecular markers that are related to the tiller angle trait in wheat and can be used in practical molecular breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular markers linked to qtl QTA-2B linked to tiller angle in wheat and its application
  • Molecular markers linked to qtl QTA-2B linked to tiller angle in wheat and its application
  • Molecular markers linked to qtl QTA-2B linked to tiller angle in wheat and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Obtainment of Wheat Tiller Angle QTL QTA-2B and Its Molecular Marker KASP-sicau1

[0043] (1) Using the wheat line '20828' as the female parent and the wheat variety 'SY95-71' as the male parent to cross, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 7 Generations, recombinant inbred lines containing 128 lines were obtained to form a genetic mapping population.

[0044] (2) Recombinant inbred line population tiller angle phenotype identification: analyze and identify the tiller angle of the recombinant inbred line at wheat maturity stage, remove the individual plants at both ends of each row, collect five individual plants with the same growth respectively, and calculate the tiller angle, And get the average value, representing the tiller angle of the line.

[0045] (3) 55K SNP chip analysis

[0046] a) DNA extraction: DNA of parent '20828', 'CN16' and recombinant inbred line population plants was extracted ...

Embodiment 2

[0062] Example 2 Application of Molecular Marker KASP-sicau1 in Selection and Control of Tiller Angle QTL QTA-2B

[0063] (1) The common wheat line 'K13-868' with a smaller tiller angle was used as the female parent, and the common wheat line 'SY95-71' with a larger tiller angle was used as the male parent to construct a recombinant inbred line, and randomly selected among the offspring lines 70 strains.

[0064] (2) Carry out KASP-sicau1 marker detection on the obtained 70 strains, the specific method is: extract the DNA of 70 strains; use it as a template, and perform PCR with the specific primer pair of molecular marker KASP-sicau1 as primers To amplify and perform a fluorescent readout, the primers are:

[0065] Primers on the FAM tag: (the underlined part is the FAM tag sequence)

[0066] 5'- GAAGGTGACCAAGTTCATGCT CCATGAACTCGTAACATGTTA

[0067] -3' (SEQ ID No.1)

[0068] Primers on the HEX tag: (the wavy part is the HEX tag sequence)

[0069] 5'- GAAGGTCGGAGTCAAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a wheat tiller angle QTL QTA‑2B linked molecular marker and its application. The KASP‑sicau1 molecular marker is a SNP molecular marker, and the polymorphism is A / G. It co-localizes with wheat tiller angle QTL QTA‑2B on the long arm of wheat chromosome 2B, and is located in the QTL QTA‑2B interval. The molecular marker KASP-sicau1 disclosed in the present invention is extremely significantly correlated with the tiller angle QTL QTA-2B, presents the characteristics of closely linked markers, has high accuracy for molecular marker-assisted selection, and can significantly improve wheat varieties with larger tiller angles adapted to different environments The selection and identification efficiency is high, and the success rate is high.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology and crop genetic breeding, and specifically relates to a SNP molecular marker linked with wheat tiller angle QTL QTA-2B and an application thereof. Background technique [0002] Common wheat (Triticum aestivum L.) is the main food crop in the world, with an annual planting area of ​​about 4.5 million hectares. Rapid growth in annual wheat production is urgently needed due to the continued decrease in the global arable land area and the increase in population. [0003] Reasonable plant structure can greatly improve crop yield. There are many agronomic traits that affect plant architecture, including panicle shape, tiller number, tiller angle, flag leaf angle, and plant height. Tiller angle is an important agronomic trait in cereal crops that shapes plant architecture and increases grain yield. Tiller angle is the angle between the main stem and its tillers. Wheat tillering directly a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6851C12N15/11A01H1/04
CPCA01H1/04C12Q1/6851C12Q1/6895C12Q2600/13C12Q2600/156C12Q2531/113C12Q2563/107
Inventor 马建郑有良刘家君兰秀锦魏育明江千涛刘亚西陈国跃
Owner SICHUAN AGRI UNIV