African swine fever virus droplet type digital PCR detection method and application thereof
An African swine fever virus and detection method technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. Inconvenience in epidemic prevention work
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] The African swine fever virus droplet digital PCR detection method of the present embodiment comprises the following steps:
[0043] (1) Design and synthesis of primers, probes and recombinant plasmids:
[0044] The first set of primers, probes and recombinant plasmids:
[0045] Upstream primer sequence F: 5'-CAGGCAAAAACAAGTGAAACA-3' (sequence 1), downstream primer sequence R: 5'-GCAAACTGCTCATCCAATAT-3' (sequence 2), probe (Probe): TGTTCTTCACGC GTAGCGAATGGGC (sequence 3); The 5' end is marked with a FAM fluorescent reporter group, and the 3' end is marked with a fluorescent quencher group BHQ1; African swine fever virus nucleic acid K205 sequence: CAGGCAA AACAAGTGAA ACACCTAAAA AAATCCCAC GAATGCAATG TTCTTCACGCGTAGCGAATG GGCATCCTCG AAAACTTTTC GAGAAAAGTT TTTAACACCA GAAATTCAGG CCATATTGGATGAGCAGTTT GC (sequence 4).
[0046] or an alternative:
[0047] The second set of primers, probes and recombinant plasmids: Upstream primer sequence F: 5'-CTGCTCATGGTATCAATCTTATCGA-3' (Seq...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com