African swine fever virus droplet type digital PCR detection method and application thereof

An African swine fever virus and detection method technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. Inconvenience in epidemic prevention work

Pending Publication Date: 2020-10-30
湖南省食品质量监督检验研究院
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The most commonly used detection technology is qPCR, but this technology cannot achieve accurate quantification, and false negative and false positive results may occur in actual work, which brings great inconvenience to the epidemic prevention work of African swine fever

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • African swine fever virus droplet type digital PCR detection method and application thereof
  • African swine fever virus droplet type digital PCR detection method and application thereof
  • African swine fever virus droplet type digital PCR detection method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] The African swine fever virus droplet digital PCR detection method of the present embodiment comprises the following steps:

[0043] (1) Design and synthesis of primers, probes and recombinant plasmids:

[0044] The first set of primers, probes and recombinant plasmids:

[0045] Upstream primer sequence F: 5'-CAGGCAAAAACAAGTGAAACA-3' (sequence 1), downstream primer sequence R: 5'-GCAAACTGCTCATCCAATAT-3' (sequence 2), probe (Probe): TGTTCTTCACGC GTAGCGAATGGGC (sequence 3); The 5' end is marked with a FAM fluorescent reporter group, and the 3' end is marked with a fluorescent quencher group BHQ1; African swine fever virus nucleic acid K205 sequence: CAGGCAA AACAAGTGAA ACACCTAAAA AAATCCCAC GAATGCAATG TTCTTCACGCGTAGCGAATG GGCATCCTCG AAAACTTTTC GAGAAAAGTT TTTAACACCA GAAATTCAGG CCATATTGGATGAGCAGTTT GC (sequence 4).

[0046] or an alternative:

[0047] The second set of primers, probes and recombinant plasmids: Upstream primer sequence F: 5'-CTGCTCATGGTATCAATCTTATCGA-3' (Seq...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an African swine fever virus droplet type digital PCR detection method and application thereof. The African swine fever virus droplet type digital PCR detection method comprises the following steps: (1) designing and synthesizing primers, probes and recombinant plasmids; and (2) adopting a droplet digital PCR reaction to obtain a qualitative or quantitative result. The African swine fever virus droplet type digital PCR detection method is applied to detection of the African swine fever virus. Three pairs of primers and probes are optimized after design according to twoconserved sequences of African swine fever virus nucleic acid, the African swine fever virus ddPCR detection method is established, and the African swine fever virus ddPCR detection method has the advantages of strong specificity, higher sensitivity, higher accuracy, stronger anti-interference ability and better repeatability, and can effectively avoid the occurrence of false negative and false positive results; understanding and control of the African swine fever epidemic situation are facilitated, and strict control of pork dead of African swine fever and marketing of pork products in the market is also facilitated.

Description

technical field [0001] The invention relates to an African swine fever virus detection method and its application, in particular to a African swine fever virus droplet digital PCR detection method and its application. Background technique [0002] African swine fever (African swine fever, ASF) is an acute, hemorrhagic infectious disease of pigs caused by African swine fever virus (ASFV). The World Organization for Animal Health (Office International des Epizooties, OIE) listed it as a legally reported infectious disease, and my country listed it as a first-class infectious disease. The "National Medium and Long-term Animal Disease Prevention and Control Plan (2012-2020)" issued by the General Office of the State Council Among them, African swine fever is also one of the 13 foreign animal diseases that should be guarded against. African swine fever broke out in Georgia in April 2007. In November of the same year, the first case of African swine fever occurred in Russia, which ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/701C12Q1/686C12Q2563/159
Inventor 宋晟
Owner 湖南省食品质量监督检验研究院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap