Kit for rapidly detecting malignant transformation of passage stem cells and application of kit
A kit and stem cell technology, applied in the field of stem cells, can solve problems such as difficult diagnosis, and achieve the effects of good accuracy, high sensitivity and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The Taq enzyme used in this example was purchased from Dalian Bao Biological Company (TaKaRa); the cell genome extraction kit was AxyPrepTM Multisource Genomic DNA Miniprep Kit (Axygen Scientific, Inc. CA, USA); the vulcanization kit was EZ DNA Methylation kit (Zymo Research, Orange, CA, USA); other reagents were domestic analytical reagents.
[0035] The stem cells used in this example are stem cells isolated from different cancer tissues.
[0036] The primers involved in this embodiment are:
[0037] Target gene P16 forward primer: TTATTAGAGGGTGGGGCGGATCGC
[0038] Target gene P16 reverse primer: GACCCCGAACCGCGACCGTAA
[0039] Target gene RASSF1A forward primer: GACCTCTGTGGCGACTTCATCTG
[0040] Target gene RASSF1A reverse primer: GACCTAGTCCTCGGGAGCTGTC
[0041] Target gene GSTP1 forward primer: TTCGGGGTGTAGCGGTCGTC
[0042] Target gene GSTP1 reverse primer: GCCCCAATACTAAATCACGACG
[0043] Target gene CDH1 forward primer: TTAGGTTAGAGGGTTATCGCGT
[0044] Target g...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



