Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of method that extracellular enzyme reaction generates acetylacetone

A technology of acetylacetone and extracellular enzymes, applied in the field of bioengineering, can solve the problems of low production of acetylacetone

Active Publication Date: 2021-12-21
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because acetylacetone is toxic to microbial cells (Water Research, 1980,14(3):231-241.), the output of acetylacetone is relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method that extracellular enzyme reaction generates acetylacetone
  • A kind of method that extracellular enzyme reaction generates acetylacetone

Examples

Experimental program
Comparison scheme
Effect test

preparation example

[0034] Preparation example Preparation of the acetylacetone lyase mutant coding gene sequence Dke1K15Q that improves the synthesis efficiency of acetylacetone

[0035] Codon optimization was performed on the acetylacetone lyase gene sequence derived from Acinetobacter johnsonii, and the gene (SEQ ID NO.4) was synthesized by Suzhou Jinweizhi Company. Using the synthesized gene as a template, use site-directed mutagenesis to design primers.

[0036] The upstream fragment of the dke1 gene (primers: F: CGGGATCCGATGGACTACTGCAACA and R: TTGTTGTCAGAGATTTGAACGTATTCTT) and the downstream fragment (primers: F: AAGAATACGTTCAAATCTCTGACAAAA and R: CGGAATTCTTAAGCAGCTTCGTTTTTGGTA) were obtained by PCR amplification, and then the target fragment was recovered using a recovery kit. The upstream and downstream fragments obtained are used as substrates, and the acetylacetonate lyase mutant gene sequence Dke1 K15Q in which the 15th lysine is changed to glutamine is obtained by bridging PCR (prime...

Embodiment 1

[0038] The obtained Dke1 K15Q fragment and plasmid pETDuet-1 were digested with BamHI and EcoRI, and the digested product was recovered; then ligated: the recovered vector and the dke1 gene fragment were ligated at a molar ratio of 1:5 at 16°C for more than 6 hours; recovered The product was ligated to obtain the expression vector of the gene encoding the acetylacetone lyase mutant that improves the synthesis efficiency of acetylacetone, which was named pETDuet-Dke1 K15Q.

[0039] The obtained vector pETDuet-Dke1 K15Q was introduced into E.coli BL21(DE3) competent cells, and coated in a medium containing 100 μg·mL -1 Ampicillin LB solid plate; place the coated plate in a constant temperature incubator at 37°C, and continue to culture until a single colony grows. Pick a single clone and streak it on a solid LB plate, continue culturing in a 37°C constant temperature incubator until the single clone grows again, use the single clone as a template, and verify it by colony PCR (pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for generating acetylacetone by extracellular enzyme reaction, which belongs to the technical field of bioengineering. The method comprises the following steps: 1) making the acetylacetone lyase mutant gene Dke1 K15Q Connecting to the expression vector to obtain a recombinant vector; 2) transforming the recombinant vector obtained in step 1) into a host bacterium to obtain a recombinant bacterium, fermenting and culturing the recombinant bacterium to obtain a culture medium; 3) treating the culture medium obtained in step 2) to obtain an enzyme 4) reacting after mixing the enzyme solution obtained in step 3) with the reaction substrate to prepare acetylacetone. The method provided by the invention can use enzyme reaction to convert methylglyoxal and ammonium acetate into acetylacetone in vitro, and the yield reaches 388.9 mg / L, which provides a solution to the problem of inhibition of the toxicity of acetylacetone to cells in the whole cell synthesis system new ideas.

Description

technical field [0001] The invention relates to a method for generating acetylacetone by extracellular enzyme reaction, belonging to the technical field of bioengineering. Background technique [0002] Acetylacetone, also known as 2,4-pentanedione, is widely used in many industries such as medicine, agriculture, and chemical industry. Existing acetylacetone is mainly obtained by chemical synthesis, which generally has disadvantages such as low yield, high energy consumption, high cost, and high pressure on environmental protection, which does not meet the needs of today's low-carbon economy. Biological synthesis has high efficiency, low energy consumption, low cost, and can avoid the generation of a large number of pollutants. Compared with chemical methods, it has obvious advantages. [0003] Methods for the biosynthesis of acetylacetone have not attracted widespread attention. In the Chinese patent CN201810865467.0, by optimizing the nucleotide sequence of the acetylacet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12P7/28C12N9/02C12N15/70C12R1/19
CPCC12P7/28C12N9/0069C12N15/70C12Y113/1105
Inventor 咸漠冯新军周怡斐赵广
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More