A kind of method that extracellular enzyme reaction generates acetylacetone
A technology of acetylacetone and extracellular enzymes, applied in the field of bioengineering, can solve the problems of low production of acetylacetone
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example
[0034] Preparation example Preparation of the acetylacetone lyase mutant coding gene sequence Dke1K15Q that improves the synthesis efficiency of acetylacetone
[0035] Codon optimization was performed on the acetylacetone lyase gene sequence derived from Acinetobacter johnsonii, and the gene (SEQ ID NO.4) was synthesized by Suzhou Jinweizhi Company. Using the synthesized gene as a template, use site-directed mutagenesis to design primers.
[0036] The upstream fragment of the dke1 gene (primers: F: CGGGATCCGATGGACTACTGCAACA and R: TTGTTGTCAGAGATTTGAACGTATTCTT) and the downstream fragment (primers: F: AAGAATACGTTCAAATCTCTGACAAAA and R: CGGAATTCTTAAGCAGCTTCGTTTTTGGTA) were obtained by PCR amplification, and then the target fragment was recovered using a recovery kit. The upstream and downstream fragments obtained are used as substrates, and the acetylacetonate lyase mutant gene sequence Dke1 K15Q in which the 15th lysine is changed to glutamine is obtained by bridging PCR (prime...
Embodiment 1
[0038] The obtained Dke1 K15Q fragment and plasmid pETDuet-1 were digested with BamHI and EcoRI, and the digested product was recovered; then ligated: the recovered vector and the dke1 gene fragment were ligated at a molar ratio of 1:5 at 16°C for more than 6 hours; recovered The product was ligated to obtain the expression vector of the gene encoding the acetylacetone lyase mutant that improves the synthesis efficiency of acetylacetone, which was named pETDuet-Dke1 K15Q.
[0039] The obtained vector pETDuet-Dke1 K15Q was introduced into E.coli BL21(DE3) competent cells, and coated in a medium containing 100 μg·mL -1 Ampicillin LB solid plate; place the coated plate in a constant temperature incubator at 37°C, and continue to culture until a single colony grows. Pick a single clone and streak it on a solid LB plate, continue culturing in a 37°C constant temperature incubator until the single clone grows again, use the single clone as a template, and verify it by colony PCR (pr...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap