Method for generating acetylacetone through extracellular enzyme reaction

A technology of acetylacetone and extracellular enzymes, applied in the field of bioengineering, can solve the problems of low production of acetylacetone

Active Publication Date: 2020-12-01
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because acetylacetone is toxic to microbial cells (Water Research, 1980,14(3):231-241.), the output of acetylacetone is relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for generating acetylacetone through extracellular enzyme reaction
  • Method for generating acetylacetone through extracellular enzyme reaction

Examples

Experimental program
Comparison scheme
Effect test

preparation example

[0034] Preparation example Preparation of the acetylacetone lyase mutant coding gene sequence Dke1 that improves the synthesis efficiency of acetylacetone K15Q

[0035] Codon optimization was performed on the acetylacetone lyase gene sequence derived from Acinetobacter johnsonii, and the gene (SEQ ID NO.4) was synthesized by Suzhou Jinweizhi Company. Using the synthesized gene as a template, use site-directed mutagenesis to design primers.

[0036] The upstream fragment of the dke1 gene (primers: F: CGGGATCCGATGGACTACTGCAACA and R: TTGTTGTCAGAGATTTGAACGTATTCTT) and the downstream fragment (primers: F: AAGAATACGTTCAAATCTCTGACAAAA and R: CGGAATTCTTAAGCAGCTTCGTTTTTGGTA) were obtained by PCR amplification, and then the target fragment was recovered using a recovery kit. The obtained upstream and downstream fragments were used as substrates, and the acetylacetone lyase mutant gene sequence Dke1 in which the 15th lysine was changed to glutamine was obtained by bridging PCR (primers...

Embodiment 1

[0038] Dke1 will be obtained K15Q The fragment and plasmid pETDuet-1 were digested with BamHI and EcoRI, and the digested product was recovered; then ligated: the recovered vector and the dke1 gene fragment were ligated at a molar ratio of 1:5 at 16°C for more than 6 hours; the ligated product was recovered and improved The expression vector of the gene encoding the acetylacetone lyase mutant of acetylacetone synthesis efficiency, named pETDuet-Dke1 K15Q .

[0039] The obtained vector pETDuet-Dke1 K15Q Introduce E.coli BL21(DE3) competent cells, spread in the -1 Ampicillin LB solid plate; place the coated plate in a constant temperature incubator at 37°C, and continue to culture until a single colony grows. Pick a single clone and streak it on a solid LB plate, continue culturing in a 37°C constant temperature incubator until the single clone grows again, use the single clone as a template, and verify it by colony PCR (primers are F: GATGCGTCCGGCGTAGAGC and R: GCTAGTTATTGCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for generating acetylacetone through an extracellular enzyme reaction, and belongs to the technical field of bioengineering. The method comprises the following steps:1) connecting an acetylacetone lyase mutant gene Dke1<K15Q> to an expression vector to obtain a recombinant vector; 2) transforming the recombinant vector obtained in the step 1) into host bacteria toobtain recombinant bacteria, and performing fermentation culture on the recombinant bacteria to obtain a culture solution; 3) treating the culture solution obtained in the step 2) to obtain an enzymesolution; and 4) mixing the enzyme solution obtained in the step 3) with reaction substrates, and then carrying out a reaction to prepare acetylacetone. According to the method provided by the invention, methylglyoxal and ammonium acetate can be converted into acetylacetone by utilizing the enzyme reaction in vitro, the yield reaches 388.9 mg / L, and a new thought is provided for solving the problem of toxicity inhibition of acetylacetone on cells in a whole-cell synthesis system.

Description

technical field [0001] The invention relates to a method for generating acetylacetone by extracellular enzyme reaction, belonging to the technical field of bioengineering. Background technique [0002] Acetylacetone, also known as 2,4-pentanedione, is widely used in many industries such as medicine, agriculture, and chemical industry. Existing acetylacetone is mainly obtained by chemical synthesis, which generally has disadvantages such as low yield, high energy consumption, high cost, and high pressure on environmental protection, which does not meet the needs of today's low-carbon economy. Biological synthesis has high efficiency, low energy consumption, low cost, and can avoid the generation of a large number of pollutants. Compared with chemical methods, it has obvious advantages. [0003] Methods for the biosynthesis of acetylacetone have not attracted widespread attention. In the Chinese patent CN201810865467.0, by optimizing the nucleotide sequence of the acetylacet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P7/28C12N9/02C12N15/70C12R1/19
CPCC12P7/28C12N9/0069C12N15/70C12Y113/1105
Inventor咸漠冯新军周怡斐赵广
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI