Primer group for amplifying cronobacter kronoi MLST (multiple-locus typing) tracing housekeeping genes, next-generation sequencing library building method and application
A Cronobacter, next-generation sequencing library technology, applied in biochemical equipment and methods, ICT adaptation, microbial measurement/inspection, etc., can solve the problems of heavy workload and complicated operation, and reduce workload and operation The effect of simple and convenient sequencing work
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] Using the information presented in Table 1, Table 2, and Table 3, perform the following experiments:
[0071] 1. One round of amplification
[0072] 1) In addition to the sequence used for gene synthesis, the first-round primer will also have a general sequence for the second-round primer combination amplification. Taking the aptD gene primer as an example, F1 (SEQ ID NO.19+SEQ ID NO.1): ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGTGTACGGCCAGATGAAC;
[0073] R1 (SEQ ID NO. 20+SEQ ID NO. 2): GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGCTCCTGGCCTACTACCAG.
[0074] 2) One-round amplification system: 25 μL: Cronos strain gDNA 5ng, 2×Mix 12.5 μL, primer mixture 5 μL, the balance is H 2 O.
[0075] 3) Amplification program: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 26 cycles; extension at 72°C for 5 min, and the product of one round was stored at 4°C.
[0076] 4) Purification of amplification products (1×beads) ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



