Amplification method for analyzing CGG repeat number of upstream untranslated region of fragile X mental retardation 1 (FMR1) gene

A technique of untranslated regions and repeat numbers, applied in the field of medical laboratory science, which can solve problems such as accuracy impact

Pending Publication Date: 2021-01-05
HUADU DISTRICT GUANGZHOU CITY PEOPLES HOSPITAL
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Three-primer PCR (TRP-PCR) can increase the amount of amplified full mutations, but the amplified products are diffuse, and normal repeats will suppress extended repeats, which will affect the accuracy of detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amplification method for analyzing CGG repeat number of upstream untranslated region of fragile X mental retardation 1 (FMR1) gene
  • Amplification method for analyzing CGG repeat number of upstream untranslated region of fragile X mental retardation 1 (FMR1) gene
  • Amplification method for analyzing CGG repeat number of upstream untranslated region of fragile X mental retardation 1 (FMR1) gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0040] Example: Using the amplification method for analyzing the number of CGG repeats in the upstream untranslated region of the FMR1 gene to detect the number of CGG repeats in the upstream region of the upstream untranslated region of the human FMR1 gene.

[0041] (1) Prepare experimental components and experimental equipment

[0042] (1) Components required for making experiments:

[0043] Preparation of recombinant TALE-deaminase: clone the gene sequence of TALE-deaminase into E. coli expression vector PET28a;

[0044] Wherein, CGG-TALE-downstream deaminase expression sequence (including start codon and stop codon):

[0045] ATGCATGGCCTGACTCCGGACCAAGTGGTGGCTATCGCCAGCCACGATGGCGGCAAGCAAGCGCTCGAAACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGACCATGGCCTGACCCCGGACCAAGTGGTGGCTATCGCCAGCAACAAGGGCGGCAAGCAAGCGCTCGAAACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGACCATGGCCTGACCCCGGACCAAGTGGTGGCTATCGCCAGCAACAAGGGCGGCAAGCAAGCGCTCGAAACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGACCATGGCCTGACTCCGGACCAAGTGGTGGCTATCGCCAGCCACG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an amplification method for analyzing a CGG repeat number of an upstream untranslated region of a fragile X mental retardation 1 (FMR1) gene, and belongs to the technical fieldof medical laboratory science. The amplification method comprises the following steps: (1) constructing three complexes that transcription activator-Like effectors (TALE) and deaminase are covalentlycoupled; (2) expressing the three complexes in escherichia coli; (3) testing the activity of proteins expressed by the three complexes; (4) extracting target DNA; (5) adding a reaction buffer and recombinant TALE-deaminase into the target DNA for reacting; (6) amplifying the DNA, after undergoing a deamination reaction, through a polymerase chain reaction (PCR); and (7) determining a sequence ofa PCR amplification product by using a Sangel sequencing method. According to the amplification method, TALE-deaminase is utilized to treat a sample, and a GC base in a specific region in the sample is directionally converted into an AT base, thereby reducing the GC content in the sample, so that isometric amplification and sequencing of the gene become feasible, and the CGG repeat number of the upstream untranslated region of the FMR1 gene is analyzed more accurately.

Description

technical field [0001] The invention belongs to the technical field of medical laboratory science, and specifically refers to an amplification method for analyzing the number of CGG repeats in the upstream untranslated region of the FMR1 gene. Background technique [0002] Fragile X syndrome (fragile X syndrome, FXS) is an X-linked genetic disease. Its typical features are moderate to severe mental retardation, giant testicles (50% of patients have a testicular volume of 30-50ml, and the normal value is 20ml), large ears, language barriers, mental retardation, and an IQ of 0-50. Most of the patients are men and the symptoms are severe in men. Females have two X chromosomes, most of them are carriers, 2 / 3 of them have normal intelligence, and 1 / 3 have mild mental retardation. In Fragile X syndrome families, diseases related to the etiology of Fragile X syndrome may appear, including Fragile X-associated tremor / ataxia syndrome (FXTAS), Fragile X-related primary Ovarian insu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6869
CPCC12Q1/6869C12Q2531/113C12Q2535/101C12Q2521/539
Inventor杜利军朱应竹谢正顺
OwnerHUADU DISTRICT GUANGZHOU CITY PEOPLES HOSPITAL