Grain type related coding gene of common wild rice and application thereof
An encoding gene and wild rice technology, which is applied to common wild rice grain type-related encoding genes and their application fields, can solve the problems of small selection range of excellent genes in rice, narrow gene source range, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Construction of overexpression vector of common wild rice grain type related gene LTG5
[0057] 1. Acquisition of LTG5 gene
[0058] Using the DNA of common wild rice Y12 (Oryzarufipogon Griff.) as a template, use the following primers primer1 and primer2 to perform PCR amplification to obtain the target gene:
[0059] primer1: 5'CGGGGTACCATGACGACAAAAGACCTTT 3';
[0060] primer2: 5' CTTAATTAATCAGCTGCGAACTCCATT 3'.
[0061] After recovering and purifying the PCR product, it was connected to Zero (purchased from Beijing Quanshijin Company) sequencing vector, transformed into DH5α competent cells, and the positive clones were selected for sequencing.
[0062] Sequencing results show that the amplified PCR product sequence is as shown in SEQ ID No.1 nucleotide sequence, the length is 1490bp, named LTG5 gene, and the amino acid sequence of the protein encoded by LTG5 gene is shown in SEQ ID No.2 .
[0063] 2. Construction of an overexpression vector (recombinant expressi...
Embodiment 2
[0068] Breeding and identification of transgenic plants overexpressing LTG5 with increased expression level of common wild rice grain type-related gene LTG5
[0069] 1. Cultivate overexpressed LTG5 transgenic plants with increased expression levels of the common wild rice grain type-related gene LTG5, and transform the indica rice 253 japonica rice with the recombinant vector OE-LTG5 through Agrobacterium tumefaciens EHA105. The specific method is as follows:
[0070] 1. Import the recombinant vector OE-LTG5 obtained in Example 1 into Agrobacterium tumefaciens EHA105 by heat shock method to obtain recombinant Agrobacterium tumefaciens EHA105 containing the recombinant vector OE-LTG5; Bacillus EHA105 was cultured at 28°C for 16 hours, and the bacterial cells were collected; the bacterial cells were diluted with N6 liquid medium (Sigma, catalog number C1416) containing 100 μM acetosyringone to obtain the diluted bacterial liquid, and the OD of the diluted bacterial liquid was 60...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


