Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Grain type related coding gene of common wild rice and application thereof

An encoding gene and wild rice technology, which is applied to common wild rice grain type-related encoding genes and their application fields, can solve the problems of small selection range of excellent genes in rice, narrow gene source range, etc.

Pending Publication Date: 2021-01-15
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The main problem of high-quality rice breeding today is the narrow range of gene sources, resulting in a limited selection of good genes in rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Grain type related coding gene of common wild rice and application thereof
  • Grain type related coding gene of common wild rice and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Construction of overexpression vector of common wild rice grain type related gene LTG5

[0057] 1. Acquisition of LTG5 gene

[0058] Using the DNA of common wild rice Y12 (Oryzarufipogon Griff.) as a template, use the following primers primer1 and primer2 to perform PCR amplification to obtain the target gene:

[0059] primer1: 5'CGGGGTACCATGACGACAAAAGACCTTT 3';

[0060] primer2: 5' CTTAATTAATCAGCTGCGAACTCCATT 3'.

[0061] After recovering and purifying the PCR product, it was connected to Zero (purchased from Beijing Quanshijin Company) sequencing vector, transformed into DH5α competent cells, and the positive clones were selected for sequencing.

[0062] Sequencing results show that the amplified PCR product sequence is as shown in SEQ ID No.1 nucleotide sequence, the length is 1490bp, named LTG5 gene, and the amino acid sequence of the protein encoded by LTG5 gene is shown in SEQ ID No.2 .

[0063] 2. Construction of an overexpression vector (recombinant expressi...

Embodiment 2

[0068] Breeding and identification of transgenic plants overexpressing LTG5 with increased expression level of common wild rice grain type-related gene LTG5

[0069] 1. Cultivate overexpressed LTG5 transgenic plants with increased expression levels of the common wild rice grain type-related gene LTG5, and transform the indica rice 253 japonica rice with the recombinant vector OE-LTG5 through Agrobacterium tumefaciens EHA105. The specific method is as follows:

[0070] 1. Import the recombinant vector OE-LTG5 obtained in Example 1 into Agrobacterium tumefaciens EHA105 by heat shock method to obtain recombinant Agrobacterium tumefaciens EHA105 containing the recombinant vector OE-LTG5; Bacillus EHA105 was cultured at 28°C for 16 hours, and the bacterial cells were collected; the bacterial cells were diluted with N6 liquid medium (Sigma, catalog number C1416) containing 100 μM acetosyringone to obtain the diluted bacterial liquid, and the OD of the diluted bacterial liquid was 60...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a grain type related coding gene LTG5 of common wild rice in regulating rice grain type. The grain type related coding gene LTG5 of common wild rice is derived from a DNA sequence of Y12 strain of oryza common wild rice (Oryzarufipogon Griff.). The regulation of the rice grain type refers to the regulation of the rice grain type to be shortened and narrowed. The grain type related gene LTG5 of common wild rice is identified for the first time, a wild rice with common grain type can be obtained under the condition of enhanced function or increased expression level of the common wild rice grain type related gene LTG5, and it is proved that common wild rice grain type related gene protein or its protein plays an important role in controlling the common wild rice grain type. The transgenic rice with increased expression of LTG5 gene obtained by the invention is used as a new rice germplasm material, and can be used for studying the grain type ricemechanism and discovering more genes for regulating the grain type development of common wild rice.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a common wild rice grain type-related coding gene and its application. Background technique [0002] Rice is one of the most important food crops for human beings, accounting for about 50% of the world's population whose staple food is rice. The demand for rice in Asia is increasing year by year. Due to rapid economic development, increasing population pressure, sharp increase in industrial land, and decrease in arable land, rice production is facing tremendous pressure. The consumer market has put forward higher demands for high-quality rice, and has more detailed requirements for the appearance of high-quality rice. Therefore, it is the main research direction of scientists to provide grain type gene resources for high-quality rice breeding. Rice grain shape is closely related to production, quality and yield. [0003] The cloned GS3 gene contains 5 exons and enc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84A01H5/10A01H6/46C07K14/415C12N15/29
CPCC12N15/8261C07K14/415
Inventor 潘英华邓国富高利军戴高兴
Owner GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com