Application of ERK/mTOR signal path regulator to preparation of a drug for improving or treating neurodevelopmental disorder related diseases

A technology of signaling pathways and modulators, which can be used in neurological diseases, gene therapy, drug combinations, etc., and can solve problems affecting neuronal plasticity, etc.

Inactive Publication Date: 2021-01-19
WENZHOU CENT HOSPITAL
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the direct relationship between the PLPPR4 gene and mental retardation and the specific mechanism of action are unknown. Existing studies have shown that the deletion of the PLPPR4 gene can lead to mental retardation, and it may be involved in regulating a series of signaling pathways to ultimately affect the plasticity of neurons. Therefore, research The signaling pathway regulated by the PLPPR4 gene plays an important role in the field of neurological diseases caused by the loss of neuron function, and has obvious implications in the fields of drug screening and disease treatment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ERK/mTOR signal path regulator to preparation of a drug for improving or treating neurodevelopmental disorder related diseases
  • Application of ERK/mTOR signal path regulator to preparation of a drug for improving or treating neurodevelopmental disorder related diseases
  • Application of ERK/mTOR signal path regulator to preparation of a drug for improving or treating neurodevelopmental disorder related diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] The present invention will be described in further detail below in conjunction with the accompanying drawings and embodiments, without limiting the present invention.

[0034] 1. Carrier Construction

[0035] 1.1. Using the pEGFP-PLPPR4 vector retained in our laboratory as a template, PCR amplification was performed to obtain the PLPPR4 cDNA fragment, whose sequence number is shown in SEQ ID NO.5. It was electrophoresed on 1.2% agarose gel at 120V for 50 minutes, and then recovered by cutting the gel.

[0036] 1.2, T clone PCR amplification electrophoresis detection

[0037] After gel cutting and recovery of the amplified fragment, the T vector was connected overnight, the competent cell was transformed, and the agar plate containing Amp antibiotic was applied, and the positive monoclonal colony was obtained after culturing overnight. Its sequence is shown in SEQ ID NO.1: CGGGCCAAGTGGTTAAAAGC, and BGH universal primer, its sequence is shown in SEQ ID NO.2: TAGAAGGCACAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an application of an ERK / mTOR signal path regulator to preparation of a drug for improving or treating neurodevelopmental disorder related diseases. The ERK / mTOR signal path regulator comprises an agonist and an inhibitor, and the agonist of a specific ERK / mTOR signal path comprises PLPPR4 protein. The agonist is mainly applied to preparation of the drug or kits for promoting burst breeding and / or axon regeneration of neuron trees, and the ERK / mTOR signal path inhibitor is applied to preparation of growth inhibition cell models or animal models of neuron dendrites or axons.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of ERK / mTOR signaling pathway regulators in the preparation of drugs for improving or treating diseases related to neurodevelopmental disorders. Background technique [0002] Intellectual disability (ID) is a common birth defect, also known as mental retardation, mental retardation (Mental Retardation, MR), is a group of onset before the age of 18, obvious cognitive impairment and two or two A neurodevelopmental disability characterized by deficits in more than one adaptive behavior. The etiology of ID is complex and can be divided into genetic factors and non-genetic factors. Genetic factors are an important cause of moderate to severe ID, including gene copy number variation, gene mutation, and other genomic variations. The former two account for at least 30% of ID. Non-genetic factors are also important causes of mild intellectual disability, such as malnutrition ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K45/00A61K38/17A61K48/00A61P25/28
CPCA61K45/00A61K38/17A61K48/005A61P25/28
Inventor 唐小华徐雪琴张茜万茹
Owner WENZHOU CENT HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap