Unlock instant, AI-driven research and patent intelligence for your innovation.
Sweet potato sucrose invertase gene ibinv and its application
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A sucrose invertase and sweet potato technology, applied in the field of genetic engineering, can solve problems such as heavy workload and long time, and achieve the effects of improving resistance, enhancing resistance, broad application space and market prospect
Active Publication Date: 2022-07-15
XUZHOU INST OF AGRI SCI IN JIANGSU XUHUAI DISTRICT (JIANGSU XUZHOU SWEETPOTATO CENT) +1
View PDF7 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0003] Through traditional breeding methods, the resistance of plants to sweet potato black spot fungus can be improved to a certain extent, but traditional breeding has the problem of long time and heavy workload
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0033] Example 1 Acquisition of sweet potato sucrose invertase IbINV gene
[0034] 1. Extraction of total RNA from sweet potato
[0035] The total RNA of the fourth fully expanded leaf of Xushu 29 plant with a transplanting period of about 5w was extracted by a plant total RNA extraction kit (Beijing Tiangen Company), the RNA concentration and quality were detected by Nanodrop, and the RNA integrity was detected by electrophoresis. For specific operations, refer to the instruction manual of the total RNA extraction kit from Tiangen plants.
[0036] 2. First-strand cDNA synthesis
[0037] Genomic DNA was removed and reverse transcribed using DNaseI and AMV reverse transcriptase from Takara, and the total RNA extracted from Xushu 29 was used as a template. The removal of genomic DNA was carried out with reference to the system ratio in Table 1. After mixing, 1 μL of EDTA was added in a water bath at 37 °C for 30 min, and the reaction was terminated at 65 °C for 10 min, and the...
Embodiment 2
[0074] Example 2 The application of IbINV protein in regulating plant resistance to sweet potato black spot
[0075] 1. Construction of pGWB5-IbINV overexpression vector
[0076] Taking T-IbINV plasmid as template, the volume ratio of plasmid and water is 1:49 as PCR amplification template, the primers are specific attb-IbINV forward and reverse primers, and the primer sequences are SEQ ID NO: 5: AAAAAGCAGGCTGCATGGCCCGCCACCACTTCT ; SEQ ID NO: 6 is: AGAAAGCTGGGTCCAATTGATTGATGAAAGAG; Prepare according to the following reaction system:
[0077] Table 3. attb-IbINV PCR reaction system preparation table
[0078]
[0079] The configured system was flicked and mixed, and then dissociated. PCR amplification conditions were: pre-denaturation at 94 °C for 2 min, denaturation at 98 °C for 10 s, annealing at 60 °C for 60 s, extension at 68 °C for 30 s, cycle 20 times, and then extend at 68 °C for 6 min Then the reaction was terminated.
[0080] Using the PCR1 product as a template a...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a sweet potato sucrose invertase gene IbINV and its application, the sweet potato sucrose invertase gene is a DNA molecule shown in SEQ ID NO: 1; the protein encoded by the gene is a protein composed of an amino acid sequence shown in SEQ ID NO: 2; The vector is a recombinant vector obtained by inserting a fragment of the DNA molecule shown in SEQ ID NO. 1 with the stop codon removed and fused with the GFP gene sequence between the two attR sites of pGWB5. of the present invention IbINV The gene and the recombinant vector can regulate the resistance of the plant to black spot fungus, and the DNA molecule encoding the IbINV protein can be introduced into the target plant to obtain a transgenic plant with significantly enhanced black spot fungus resistance. provided by the present invention IbINV The gene and its encoded protein can improve the resistance of plants to black spot fungus of sweet potato, which lays the foundation for directional improvement of the resistance of plants to black spot fungus of sweet potato.
Description
technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a sweet potato sucrose invertase gene IbINV and an application thereof. Background technique [0002] Sweet potato black spot disease, also known as black spot disease, occurs in all sweet potato producing areas in the world. In 1937, the disease was introduced into Gai County, Liaoning Province, my country from Kagoshima, Japan, and gradually spread from north to south. There are currently 26 provinces, Cities and autonomous regions have reported the occurrence and harm of the disease one after another. Sweet potato black spot is common in all potato regions in China, and the damage is more serious in North China, the Huanghuaihai Basin, the Yangtze River Basin, and the southern potato region. The annual yield loss caused by sweet potato black spot disease is about 5% to 10%, and the loss caused by serious damage can reach 20% to 50%, or even higher. In ...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More