Multi-region DNA methylation detection probe design and detection method thereof
A detection method, methylation technology, applied in the direction of biochemical equipment and methods, recombinant DNA technology, DNA / RNA fragments, etc., can solve the problems of high application cost, limited effect, long time, etc., to achieve reliable technical support, detection low cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific example
[0071] Illumina
[0072] SEQ1: Linker 1: tacactctttccctacacgacgctcttccgatct
[0073] SEQ2: Linker 2: gatcggaagagcacacgtctgaactccagtcac
[0074] SEQ3: outer primer 1: aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct;
[0075]SEQ4: Outer primer 2: caagcagaagacggcatacgagatiiiiiiiigtgactggagttcagacgtgtgctcttccgatct
[0076] MGI / BGI
[0077] SEQ5: Linker 1': ttgtcttcctaaggaacgacatggctacgatccgactt
[0078] SEQ6: Linker 2': agtcggaggccaagcggtcttaggaagacaaiiiiiiiiiicaactccttggctcaca
[0079] SEQ7: outer primer 1': tgtgagccaaggagttg
[0080] SEQ8: outer primer 2': gaacgacatggctacga
[0081] Wherein, Illumina refers to adapter and primer sequences developed based on the series of sequencers of Illumina Company. MGI / BGI refers to the adapter and primer sequences developed based on the BGI MGI and BGI series sequencers. If it needs to be applied to other sequencing platforms, those skilled in the art can convert it according to actual needs.
[0082] The detection metho...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



