Unlock instant, AI-driven research and patent intelligence for your innovation.

Multi-region DNA methylation detection probe design and detection method thereof

A detection method, methylation technology, applied in the direction of biochemical equipment and methods, recombinant DNA technology, DNA / RNA fragments, etc., can solve the problems of high application cost, limited effect, long time, etc., to achieve reliable technical support, detection low cost effect

Active Publication Date: 2021-05-11
SHENZHEN E GENE TECH
View PDF16 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] In view of the above technical problems, the embodiment of the present invention provides a method for detecting DNA methylation in a multi-gene region and its probe design, and at the same time constructs a rapid library construction method for amplified products, reducing the use of enzymes And simplify the reaction process to solve the problems of high cost, long time and limited effect of clinical detection application based on DNA methylation multi-gene amplification in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multi-region DNA methylation detection probe design and detection method thereof
  • Multi-region DNA methylation detection probe design and detection method thereof
  • Multi-region DNA methylation detection probe design and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

specific example

[0071] Illumina

[0072] SEQ1: Linker 1: tacactctttccctacacgacgctcttccgatct

[0073] SEQ2: Linker 2: gatcggaagagcacacgtctgaactccagtcac

[0074] SEQ3: outer primer 1: aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct;

[0075]SEQ4: Outer primer 2: caagcagaagacggcatacgagatiiiiiiiigtgactggagttcagacgtgtgctcttccgatct

[0076] MGI / BGI

[0077] SEQ5: Linker 1': ttgtcttcctaaggaacgacatggctacgatccgactt

[0078] SEQ6: Linker 2': agtcggaggccaagcggtcttaggaagacaaiiiiiiiiiicaactccttggctcaca

[0079] SEQ7: outer primer 1': tgtgagccaaggagttg

[0080] SEQ8: outer primer 2': gaacgacatggctacga

[0081] Wherein, Illumina refers to adapter and primer sequences developed based on the series of sequencers of Illumina Company. MGI / BGI refers to the adapter and primer sequences developed based on the BGI MGI and BGI series sequencers. If it needs to be applied to other sequencing platforms, those skilled in the art can convert it according to actual needs.

[0082] The detection metho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene detection, in particular to a DNA methylation detection method of a multi-gene region and probe design application of the DNA methylation detection method. The method comprises the following steps: sulfite conversion is carried out on genome DNA to be detected; primers are designed for different target detection genes, and capture probes are constructed; PCR amplification is carried out on the target region by using a specifically designed probe; a database is built for the DNA of the amplified target region and sequencing is carried out; and original data obtained through sequencing are analyzed, amplification repetition is removed, and the methylation level of the target detection site is calculated. According to the detection method, a plurality of genes can be completely amplified at one time under the same set of template, and the operation complexity and the detection period of multi-gene methylation detection are greatly reduced.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a DNA methylation detection method in a multi-gene region and probe design thereof. Background technique [0002] DNA methylation is the most stable modification, the most abundant modification, the most active gene regulation and the most extensive pathway in epigenetic research. The modification of different gene regions or sites is closely related to embryonic development, disease occurrence and development, and is also a bridge for the influence of the external environment on the body. [0003] For DNA methylation detection, there are currently a series of different methods that can be applied to different sample types or detection requirements. [0004] For example, whole genome bisulfite sequencing (WGBS) for next-generation high-throughput sequencing platforms. It can accurately detect the methylation level of each cytosine. This technology has the widest detectio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q2523/125C12Q2531/113C12Q2535/122C12Q2547/101
Inventor 王君文胡琪苏锦玲高飞
Owner SHENZHEN E GENE TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More