Efficient plasmid vector based on ELP-Intein and ccdB and use method thereof
A plasmid vector and high-efficiency technology, applied in the field of molecular biology, can solve problems such as false positives, increased workload, screening pressure, etc., and achieve the effect of refolding and purification and increasing workload
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Embodiment 1: the acquisition of plasmid vector pANY8
[0051] 1) Using the pET3a plasmid as a template, PCR amplification was performed with primers PHis-for1 and PHis-rev1, and the amplified product was named fragment 1. The primer sequences of PHis-for1 and PHis-rev1 are: PHis-for1(5'-AAAAC TGCAG CACCACCACC ACCAC CACTA AGGCT GCTAA CAAAG CCCGA AAGGA AGCTG-3') and PHis-rev1(5'-GTAGTTTATC ACAGT TAAAT TGCTA ACGCA GTCAG GGATA TCCGG ATATA GTTCC TCCTT TC-3'). The reaction conditions for PCR amplification are: 10 μmol / L each primer, 2U Pfu enzyme, 1x Pfu buffer, 0.2mmol / L dNTPs, about 2ng template, add sterilized deionized water to 20μl. The cycle program of PCR amplification was: pre-denaturation at 94°C for 2 min, followed by 25 cycles of denaturation at 94°C for 30 s, annealing at 63°C for 30 s and extension at 72°C for 3 min. The reaction was extended at 72°C for 10 min before the end of the reaction.
[0052]2) Using the pET9a plasmid as a template, PCR amplification...
Embodiment 2
[0067] Embodiment 2: clone endo-beta-1,3-glucanase gene pfLamA with pANY8
[0068] 1) Use pfLamA-BamHI-CZM (5'-TTTGT ATTTT CAGGG GGGAT CCGTC CCTGAAGTGATAGAAATAGATGGAAAACAG TGG-3') and pfLamA-TAA-pstI (3'-CTAAC TGCAG TTAAC CACTAACGAA TGAGT AAACC CTTAC ATAAT CCACC-3') as forward and reverse primers , with plasmid pET9d-pfLamA (Ilari A, Fiorillo A, Angelaccio S, Florio R, Chiaraluce R, van der Oost J, ConsalviV. Crystal structure of a family 16endoglucanase from the hyperthermophilePyrococcus furiosus--structural basis of substrate recognition. FEBS J. 2009; 276(4):1048-1058.) as a template for PCR amplification. The reaction conditions for PCR amplification are: 10 μmol / L each primer, 2UPfu enzyme, 1x Pfu buffer, 0.2mmol / L dNTPs, about 2ng template, and add sterilized deionized water to 20μl. The cycle program of PCR amplification was: pre-denaturation at 94°C for 2 min, followed by 25 cycles of denaturation at 94°C for 30 s, annealing at 63°C for 30 s and extension at 72°C for...
Embodiment 3
[0074] Example 3: Functional verification of pANY8 for protein expression and His-ELP-Intein tag double purification
[0075] Transform the pANY8-pfLamA plasmid obtained in the above Example 2 into Escherichia coli BL21(DE3) competent cells, spread it on LB solid medium containing 50 μg / ml Kana resistance, and culture it upside down at 37°C overnight, and the second A single colony was picked daily and placed in TB liquid medium, cultured on a shaker at 37°C, and when OD600=0.4, 0.2mmol / L IPTG was added to induce expression for 5h.
[0076]1) Purification based on the ELP-intein tag: Collect the induced bacteria by centrifugation at 4000g in a 50ml centrifuge tube for 5 minutes, and resuspend in 10ml of lysis buffer (10mmol / L Tris-HCl, 2mmol / L EDTA, 0.1mg / ml lysozyme, 0 or 8mol / L urea, pH 8.5), and then sonicated. The cell lysate was centrifuged at 12,000 g at room temperature for 10 minutes to collect the supernatant, and every 200 μl of the supernatant was mixed with 0.2-2 ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| phase transition temperature | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More