Methods for altering gene expression for genetic disorders
A gene, transgenic technology, applied in the field of genome editing and gene therapy, which can solve problems such as hindering the delivery of large transgenes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0147] Example 1: DNA-targeted integration into the ATXN2 gene
[0148] Three plasmids were constructed with transgenes designed to integrate into the ATXN2 gene in human cells. All transgenes were designed to integrate within intron 2 of the ATXN2 gene, and all transgenes were designed to insert bidirectional partial coding sequences with a single promoter. Part of the coding sequence encodes a peptide produced by exon 1 of the ATXN2 gene. The first plasmid, designated pBA1141, includes left and right homology arms with sequences homologous to the start sequence of intron 1 (ie, a successful gene target into pBA1141 which will cause the carrier to be inserted into intron 1). From 5' to 3', between the homology arms, a splice donor in the reverse complement orientation, a partial coding sequence 1 with a codon adjustment in the reverse complement orientation (encoding generated from exon 1 of the ATXN2 gene) is included between the homology arms peptide), EF1α promoter in...
example 2
[0155] Example 2: Silencing of Endogenous SOD1 Gene Expression and Expression of Alternative SOD1 Protein
[0156] This document describes methods for silencing and replacing endogenous gene expression using RNAi, anti-RNAi coding sequences, and gene editing. These methods are particularly useful for gain-of-function disorders, including amyotrophic lateral sclerosis, in which there is a mutation in the SOD1 gene.
[0157] To validate gene silencing and replacement, transgenes were designed with RNAi (shRNA) cassettes targeting sequences within exon 2 of SOD1. The shRNA included the sequence GGCCTGCATGGATTCCATGTTCAAGAGACATGGAATCCATGCAGGCC (SEQ ID NO: 49) placed downstream of the U6 promoter. The transgene also includes the SOD1 coding sequence downstream of the CMV promoter. Sequences within the coding sequence were modified to avoid shRNA silencing. The sequence of the transgene (designated pBA1148) is shown in SEQ ID NO:10. A control vector including a scrambled shRNA ...
example 3
[0162] Example 3: Silencing of endogenous SNCA gene expression and expression of two SNCA protein isoforms
[0163] Mutations in SNCA have been found to cause Parkinson's disease. The methods described herein can be used to correct SNCA gene expression. In some cases, SNCA is repeated or repeated three times, resulting in overproduction of alpha-synuclein. In other cases, mutations such as Ala30Pro cause misfolding of the protein. Described herein is an expression that reduces the expression of endogenous SNCA (from gene duplications and intragenic mutations) while using some or all SNCA isoforms (presence of at least 6 transcripts of SNCA, including full-length 140aa protein, 126aa protein, 112aa protein, 98aa protein, 67aa protein and 115aa protein) to replace the method of expression of SNCA.
[0164] The transgene was designed to carry shRNA to silence endogenous SNCA gene expression. The transgene was also designed to replace the two SNCA protein isoforms by encodin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More