Male sterility gene MsJMT and application thereof
A male sterility gene, male sterility technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of long growth cycle, limitation, difficulty in increasing yield, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1, method for creating male sterile lines of alfalfa
[0027] 1.1 MsJMT gene cloning for fertility control of alfalfa
[0028] Using the conventional alfalfa variety Gongnong No. 1 as the material (hereinafter referred to as: alfalfa), specific primers were designed according to the full-length sequence of the MsJMT gene
[0029] MsJMT-25 (Sense primer) ATGGTACAGAAAAAGGTTCTTTCTT and
[0030] MsJMT-26 (Anti-sense primer) TCACACTTTTTTGGTCATTGATACGC
[0031] Extract the total RNA of anthers sequentially, synthesize cDNA and PCR amplify the full length of the cDNA of the MsJMT gene, the full length of the cDNA sequence identified by sequencing is 1047bp, such as the nucleotide sequence shown in SEQ ID NO.1, the encoding full length is 348 amino acids Alfalfa male reproductive development control protein, its sequence is shown in SEQ ID NO.2.
[0032] 1.2 Increase the expression level of MsJMT in alfalfa by means of overexpression
[0033] In order to apply th...
Embodiment 2
[0068] Embodiment 2, restore the method that MsJMT gene overexpression causes alfalfa male sterility
[0069] 2.1 Restoring the fertility of new male sterile lines by inhibiting the MsJMT gene
[0070] The nucleotide sequence encoding the MsJMT gene is silently expressed by RNAi technology and the successfully constructed pRNAi-MsJMT vector is transferred into the sterile line of alfalfa, which can restore the sterile line of alfalfa to the wild-type phenotype, wherein The pRNAi-MsJMT vector contains the nucleotide sequences shown in SEQ ID NO.3 (forward fragment) and SEQ ID NO.4 (reverse fragment).
[0071] Use the alfalfa cDNA as a template and use primers
[0072] MsJMT-RNAi (Sense primer) ACTGACGTAAGGGATGACGCAC and
[0073] MsJMT-RNAi(Anti-sense primer)GATTTGTAGAGAGAGACTGGT
[0074] A specific fragment of 569 bp from the 195th to the 764th position of the coding region sequence, so that the product contains attB sites at both ends; this fragment is inserted into the pEN...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap