Unlock instant, AI-driven research and patent intelligence for your innovation.

Male sterility gene MsJMT and application thereof

A male sterility gene, male sterility technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of long growth cycle, limitation, difficulty in increasing yield, etc.

Active Publication Date: 2021-08-06
JILIN AGRICULTURAL UNIV +1
View PDF10 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In order to improve the heterosis of alfalfa and reduce the time and economic cost caused by artificial castration, the development of excellent male sterile lines of alfalfa is currently the focus of completing the "three-line" matching of alfalfa; but the "three-line" method requires the relationship between the restorer line and the maintainer line Restrictions: It is difficult to screen new genotypes of sterile lines, resulting in low breeding efficiency and difficulty in improving yield. Therefore, screening and breeding of new genotypic sterile lines, expanding the cytoplasmic background, and laying the foundation for the utilization of heterosis in perennial pastures
[0003] Although research on alfalfa breeding has been going on, it is difficult to select high-quality male sterile lines and supporting line materials in the process of hybrid breeding. At the same time, as a tetraploid plant, the genome is relatively complex and the growth cycle is long. It also limits the progress of its hybridization and heterosis utilization in the genetic basis of fertility and genetic models.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Male sterility gene MsJMT and application thereof
  • Male sterility gene MsJMT and application thereof
  • Male sterility gene MsJMT and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, method for creating male sterile lines of alfalfa

[0027] 1.1 MsJMT gene cloning for fertility control of alfalfa

[0028] Using the conventional alfalfa variety Gongnong No. 1 as the material (hereinafter referred to as: alfalfa), specific primers were designed according to the full-length sequence of the MsJMT gene

[0029] MsJMT-25 (Sense primer) ATGGTACAGAAAAAGGTTCTTTCTT and

[0030] MsJMT-26 (Anti-sense primer) TCACACTTTTTTGGTCATTGATACGC

[0031] Extract the total RNA of anthers sequentially, synthesize cDNA and PCR amplify the full length of the cDNA of the MsJMT gene, the full length of the cDNA sequence identified by sequencing is 1047bp, such as the nucleotide sequence shown in SEQ ID NO.1, the encoding full length is 348 amino acids Alfalfa male reproductive development control protein, its sequence is shown in SEQ ID NO.2.

[0032] 1.2 Increase the expression level of MsJMT in alfalfa by means of overexpression

[0033] In order to apply th...

Embodiment 2

[0068] Embodiment 2, restore the method that MsJMT gene overexpression causes alfalfa male sterility

[0069] 2.1 Restoring the fertility of new male sterile lines by inhibiting the MsJMT gene

[0070] The nucleotide sequence encoding the MsJMT gene is silently expressed by RNAi technology and the successfully constructed pRNAi-MsJMT vector is transferred into the sterile line of alfalfa, which can restore the sterile line of alfalfa to the wild-type phenotype, wherein The pRNAi-MsJMT vector contains the nucleotide sequences shown in SEQ ID NO.3 (forward fragment) and SEQ ID NO.4 (reverse fragment).

[0071] Use the alfalfa cDNA as a template and use primers

[0072] MsJMT-RNAi (Sense primer) ACTGACGTAAGGGATGACGCAC and

[0073] MsJMT-RNAi(Anti-sense primer)GATTTGTAGAGAGAGACTGGT

[0074] A specific fragment of 569 bp from the 195th to the 764th position of the coding region sequence, so that the product contains attB sites at both ends; this fragment is inserted into the pEN...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a male sterility gene MsJMT and a method for restoring male sterility of medicago sativa, and belongs to the technical field of bioengineering. The invention provides application of an MsJMT gene; the MsJMT gene has a nucleotide sequence as shown in SEQ ID NO.1; the application comprises the following steps of overexpressing the MsJMT gene to obtain a male sterile line of medicago sativa, and producing seeds by using the male sterile line of medicago sativa. The invention also provides a method for restoring MsJMT gene overexpression to cause male sterility of medicago sativa, which comprises the following steps off constructing an RNAi expression vector, and transforming the bred medicago sativa male sterile line by using a genetic transformation means to restore the fertility and wild phenotype of the medicago sativa male sterile line. The created medicago sativa male sterile line and the provided method for recovering the fertility of the male sterile line have very important application in hybridized medicago sativa construction and agricultural production.

Description

technical field [0001] The invention relates to a method for creating alfalfa strains in the technical field of bioengineering, in particular to a male sterility gene MsJMT and its application. Background technique [0002] Alfalfa (Medicago sativa L.) is a high-quality perennial leguminous forage, known as the "king of forage", and has a long history of cultivation in my country. As a typical hermaphroditic cross-pollinated plant, it has self-incompatibility, and hybridization is required for seed production. Compared with ordinary alfalfa varieties, the hybrid alfalfa cultivated by the "three-line method" has the advantages of taller plants, stronger stress resistance, and higher proportion of leaves. Due to the obvious heterosis, the use of this advantage in seed production in practical applications is mainly divided into two ways: artificial emasculation hybrid seed production and nuclear-cytoplasmic interaction male sterile line hybrid seed production. The latter can n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/54
CPCC07K14/415C12N15/8289
Inventor 徐博王英哲徐小博孟悦徐安凯张南翼
Owner JILIN AGRICULTURAL UNIV