Application of male sterility gene osdpw3 and method for restoring rice fertility

A male sterility gene and male sterility technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the limitation of the relationship between restorer lines and maintainer lines, the difficulty of screening excellent combinations, and the complex performance of three-line hybrid rice seeds. and other problems to achieve the effect of reducing labor costs and improving production efficiency

Active Publication Date: 2021-10-29
SHANGHAI JIAO TONG UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the performance of three-line hybrid rice seed dominance is complex, limited by the relationship between the restorer line and the maintainer line, making it difficult to select excellent combinations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of male sterility gene osdpw3 and method for restoring rice fertility
  • Application of male sterility gene osdpw3 and method for restoring rice fertility
  • Application of male sterility gene osdpw3 and method for restoring rice fertility

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1, the method for the creation of rice male sterile lines

[0044] 1.1 Create osdpw3 rice male sterile lines by conventional breeding methods

[0045] The osdpw3-1 mutation material in this example is obtained from the conventional japonica rice variety Wuyujing No. 7 (also known as 9522) through conventional genetic engineering methods.

[0046] Those skilled in the art know that other methods such as radiation irradiation can also be used to mutate conventional varieties of rice. If the osdpw3-1 mutant is mutated, it will cause a frame shift and premature termination of its encoded protein, which will also lead to male reproduction in rice. Organ anthers do not develop normally. Backcross the mutagenized mutants for three generations to obtain a stable genetic osdpw3-1 mutant controlled by a recessive nuclear single gene. The osdpw3-1 mutant was backcrossed with 9522, and the phenotypes of all F1 generations were consistent with 9522, showing fertility....

Embodiment 2

[0069] Embodiment 2, the purposes of osdpw3 mutant in rice seed production

[0070] The osdpw3-1 mutant was used as the male parent to cross the sterile parent in the three-line or two-line cross combination to obtain the F1 generation. In the F2 generation, a plant with both male sterility and sterility characteristics was screened, and the plant was crossed with the maintainer line corresponding to the original sterile parent. In the F2 generation, the plants with both male sterility and sterility characteristics were screened again and crossed with the maintainer line. After multiple generations of cross screening, a new male sterile line was obtained, which was suitable as the female parent in the hybrid combination.

Embodiment 3

[0071] Embodiment 3, the method for recovering osdpw3 mutant male sterility traits

[0072] Transferring the genome nucleotide sequence encoding OsDPW3 gene into the osdpw3-1 mutant plant can restore the mutant to the wild-type phenotype.

[0073] Genomic DNA was extracted from leaves of wild-type 9522 seedlings as a template, and primers were used:

[0074] 70025gDNAF (its sequence is shown in SEQ ID NO.7):

[0075] CCATGATTAC GAATTC TATTGCCTGTTTGTGGCTGGAC;

[0076] 70025gDNAR (its sequence is shown in SEQ ID NO.8):

[0077] ATTCGAGCT GGTCACC GCCGCTTACACGTTACTGTATTGG;

[0078] A 9120bp genome sequence fragment of the OsDPW3 gene as shown in SEQ ID NO.6 was amplified;

[0079] Insert the amplified DNA fragment into the binary vector pCAMBIA1301 vector used for transforming rice through the In-Fusion transformation system of Dalian Bao Biological Company; the sequencing verification is correct, and the vector is introduced into Agrobacterium tumefaciens by electropora...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of a male sterility gene OsDPW3 and a method for restoring fertility; using conventional genetic engineering methods or based on the CRISPR / Cas9 system, the OsDPW3 gene is knocked out, changed or inhibited, and the OsDPW3 is made in the wild-type rice background of japonica rice The level of gene expression is reduced, and then the male sterile line of rice is obtained. The invention also relates to a method for restoring rice fertility, which uses primers to amplify the OsDPW3 gene and transforms mutant plants by means of genetic transformation, which can restore the mutants to wild-type phenotypes. The rice male sterile line prepared by the invention has no abnormal phenotype in the rice vegetative growth period, but abnormalities appear in the anther development process in the reproductive growth period. If applied to hybrid breeding, the work of detasseling the female parent can be exempted, the production efficiency can be greatly improved, and the labor cost can be reduced. It has important applications in agricultural production.

Description

technical field [0001] The invention relates to a method for creating rice strains in the technical field of bioengineering, in particular to an application of the male sterility gene OsDPW3 and a method for restoring rice fertility. Background technique [0002] Rice is an important food crop in the world. About 50% of the world's population uses rice as a staple food. Rice is also a raw material for processing many foods. Due to the small genome of rice and the mature rice transformation system, it can be used as a model plant for monocotyledon research, but the mechanism of rice reproductive development remains to be understood. The discovery and utilization of rice male sterile lines created a new era of rice hybrid breeding and played a huge role in improving rice yield. Due to the disadvantages of unstable fertility and negative cytoplasmic effect of the sterile lines used in the current rice hybridization process, it is of great significance to conduct in-depth resea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/46A01H1/02
CPCA01H1/02C07K14/415C12N15/8213C12N15/8289
Inventor梁婉琪张大兵徐大伟袁政
OwnerSHANGHAI JIAO TONG UNIV