Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of male sterility gene osdpw2 and method for restoring rice fertility

A male sterility gene and male sterility technology, applied in the fields of application, genetic engineering, chemical instruments and methods, etc., can solve the limitation of the relationship between the restorer line and the maintainer line, the difficulty of screening excellent combinations, and the superior performance of three-line hybrid rice seeds Complicated problems, to achieve the effect of reducing labor costs and improving production efficiency

Active Publication Date: 2019-11-01
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the performance of three-line hybrid rice seed dominance is complex, limited by the relationship between the restorer line and the maintainer line, making it difficult to select excellent combinations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of male sterility gene osdpw2 and method for restoring rice fertility
  • Application of male sterility gene osdpw2 and method for restoring rice fertility
  • Application of male sterility gene osdpw2 and method for restoring rice fertility

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1. Method for creating rice male sterile lines

[0044] 1.1 Create osdpw2 rice male sterile lines through conventional breeding methods

[0045] The osdpw2 mutant material in this example was derived from conventional japonica rice variety Wuyujing 7 (also known as 9522) through conventional genetic engineering methods.

[0046] Those skilled in the art know that other methods such as radiation can also be used to mutate conventional rice varieties for mutation. 60 The osdpw2 mutant was obtained by Coγ-ray mutagenesis, and the treatment dose was 280Gy (reference method: Chen Liang, Chu Huangwei, Yuan Zheng, et al. Isolation and genetic analysis of 60Coγ-Ray mutagenic rice mutant[J].Xiamen University Journal: Natural Science Edition, 2006, (S1): 82-85). The mutagenized mutant was backcrossed for three generations to obtain a stable inherited osdpw2 mutant controlled by a recessive nuclear single gene. The osdpw2 mutant was backcrossed to 9522, and the phenotype of al...

Embodiment 2

[0067] Example 2. Use of osdpw2 mutant in rice seed production

[0068] The osdpw2 mutant was crossed with the sterile parent in the three-line or two-line cross combination as the male parent to obtain the F1 generation. In the F2 generation, plants with both male sterility and sterile characteristics are screened, and the plants are crossed with the maintainer line corresponding to the original sterile parent. In the F2 generation, the hybrid plants with both male sterility and sterile characteristics are screened again and the maintainer line is crossed. After multiple generations of cross screening, a new male sterile line is obtained, which is suitable as the female parent in the cross combination.

Embodiment 3

[0069] Example 3. Method for restoring male sterility of osdpw2 mutant

[0070] Transforming the genomic nucleotide sequence encoding the OsDPW2 gene into the mutant osdpw2 mutant plant can restore the mutant to the wild-type phenotype.

[0071] Genomic DNA was extracted from wild-type 9522 seedling leaves as a template, using primers:

[0072] 70025gDNAF (the sequence is shown in SEQ ID NO. 7):

[0073] CCATGATTAC GAATTC TATTGCCTGTTTGTGGCTGGAC,

[0074] 70025gDNAR (the sequence is shown in SEQ ID NO. 8): ATTCGAGCT GGTCACC GCCGCTTACACGTTACTGTATTGG

[0075] Amplify the 5997bp genomic sequence fragment of OsDPW2 gene as shown in SEQ ID NO.6;

[0076] The fragment was inserted into the binary vector DCAMBIA1301 vector used to transform rice through the In-Fusion transformation system of Dalian Bao Biological Company; the sequencing verification was correct, and the vector was introduced into Agrobacterium tumefaciens by electric shock. ) EHA105 obtains OsDPW2 complementary Agrobacterium...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of male sterility gene OsDPW2 and a rice sterility recovery method. OsDPW2 gene is knocked out, changed or inhibited by using the conventional genetic engineering method or on the basis of a CRISPR / Cas9 system, and the expression level of the OsDPW2 gene is reduced in japonica rice background wild type rice, so that a rice male sterility line is obtained. The invention further relates to the rice sterility recovery method, the OsDPW2 gene is amplified by primers, a mutant plant is transformed by a genetic transformation means, and a mutant can be recovered to be in wild phenotype. In a rice nutritional growth period of the rice male sterility line prepared by the invention, abnormal phenotypes do not exist; but in an anther development process of a reproductive growth period, abnormal phenotypes exist. If the male sterility gene OsDPW2 is used in cross breeding, operation of female parent emasculation can be avoided, production efficiency is greatly improved, labor cost is reduced, and the male sterility gene OsDPW2 has important application on agricultural production.

Description

Technical field [0001] The invention relates to a method for creating rice strains in the technical field of bioengineering, in particular to the application of a male sterility gene OsDPW2 and a method for restoring rice fertility. Background technique [0002] Rice is an important food crop in the world. About 50% of the world's population feed on rice, which is also the raw material for processing many foods. Due to the small genome of rice and the mature rice transformation system, it can be used as a model plant for monocot research. People still need to understand the mechanism of rice reproduction and development. The discovery and utilization of rice male sterile lines opened up a new era of rice hybrid breeding and played a huge role in increasing rice yield. Due to the shortcomings of the current sterile lines used in rice hybridization, such as unstable fertility and negative cytoplasmic effects, in-depth research on the regulation mechanism of male sterility in rice ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/46C07K14/415
CPCC07K14/415C12N15/8205C12N15/8216C12N15/8231C12N2810/10C12N2999/007
Inventor 梁婉琪张大兵徐大伟袁政陈明姣罗治靖
Owner SHANGHAI JIAO TONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More