Unlock instant, AI-driven research and patent intelligence for your innovation.

A chimeric antigen receptor T cell targeting CD133

A chimeric antigen receptor and targeting technology, applied in the direction of targeting specific cell fusion, genetically modified cells, receptors/cell surface antigens/cell surface determinants, etc., can solve the complexity of cell signal transduction and other issues, to achieve the effect of strong specific killing function, remarkable ability and strong anti-tumor ability

Active Publication Date: 2022-05-13
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Blocking the combination of PD-L1 and PD1 can theoretically eliminate the inhibition of PD1 signaling on T cells and activate the immune response of T cells. However, due to the complexity of cell signal transduction, it is currently not possible to simultaneously target CD133+ tumor stem cells and target Report on CAR-T cells of PD1-PDL1 pathway

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A chimeric antigen receptor T cell targeting CD133
  • A chimeric antigen receptor T cell targeting CD133
  • A chimeric antigen receptor T cell targeting CD133

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 Preparation of anti-tumor chimeric antigen receptor T cells

[0059] 1. Lentivirus construction

[0060] 1. Construction of lentiviral vector plasmid

[0061] 1.1 Design CD133scFv gene sequence

[0062] There are 2 articles in total, namely:

[0063] CD133scFv gene sequence (SEQ ID NO.1):

[0064] GCCCAGGCCGCCGAGCTGGACATCGTGCTGAGCCAGAGCCCCGCC ATCATGAGCGCCAGCCCCGGCGAGAAGGTGACCATCAGCTGCAGCGCC AGCAGCAGCGTGAGCTACATGTACTGGTACCAGCAGAAGCCCGGCAGCAGCCCCAAGCCCTGGATCTACAGAACCAGCAACCTGGCCAGCGGCGTG CCCGCCAGATTCAGCGGCAGCGGCAGCGGCACCAGCTACAGCCTGACC ATCAGCAGCATGGAGGCCGAGGACGCCGCCACATATTACTGCCAGCAG TACCACAGCTACCCCCCCACATTCGGAGCTGGCACGAAACTGGAGCTG AAATCGAGCGGCGGCGGCGGCTCTGGCGGGGGCGGAGGCGGTTCTAG CAGAAGCAGCCTGGAGGTGAAGCTGGTGGAAAGCGGCCCGGAACTGA AGAAGCCCGGCGAGACCGTGAAGATCAGCTGCAAGGCCAGCGGCTAC ACCTTCACCGACTACAGCATGCACTGGGTGAACCAGGCCCCCGGCAAG GGCCTGAAGTGGATGGGCTGGATCAACACCGAGACCGGCGAGCCCAG CTACGCCGACGACTTCAAGGGCAGATTCGCCTTCAGCCTGGAGACCAG CGCCAGCACCGCCTACCTGCAGATCAACAACCTGAAGAACGAGG...

Embodiment 2

[0096] Example 2 Preparation of CART cells modified by switching receptors

[0097] Through the whole gene synthesis method, synthesize the DNA sequence that connects the switch receptor gene sequence, CD133scFv gene sequence and signal peptide, CD28 hinge segment, CD28 transmembrane segment, CD28 intracellular segment, and CD3ζ segment respectively, in the order of signal peptide-switch Receptor-T2A linker-signal peptide-anti-CD133 single-chain antibody-CD28 hinge, transmembrane segment and intracellular segment-CD3ζ segment, its sequence (SEQ ID NO.18) is:

[0098]

[0099]

[0100] Note: The lowercase non-italic part (SEQ ID NO.3) is the signal peptide; the uppercase non-bold part (SEQ ID NO.13) is the anti-PDL1 sequence; the lowercase italic part (SEQ ID NO.20) is the CD28 hinge (hinge ), transmembrane and intracellular segment; the uppercase underlined part (SEQ ID NO.14) is the T2A linker; the uppercase bold part (SEQ ID NO.1) is the sequence of the anti-CD133 sing...

experiment example 1

[0124] Experimental example 1 Detection of infection efficiency of CD133 CART cells

[0125] 1. Cell preparation

[0126] CD133 CART cells (prepared according to Example 1), empty T cells (on the basis of Example 1, the CD133 CART gene fragment was omitted, and the lentiviral empty vector was transferred), and control T cells.

[0127] 2. Flow detection

[0128] The red fluorescence expression of each sample was detected and analyzed by flow cytometry.

[0129] 3. Results

[0130] The result is as Figure 5 shown. The test results showed that the ratio of CD133 CART cells expressing red fluorescence (RFP) was 75.6%, the ratio of empty T cells expressing RFP was 74.3%, and the control T cells did not express RFP.

[0131] 4 Conclusion

[0132] The CD133 CART cells of the present invention have higher infection efficiency.

[0133] Experimental example 2 Detection of cell infection efficiency of CD133 CART (CD133-αPDL1 / CD28-CART cells) modified by switching receptors

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chimeric antigen receptor T cell targeting CD133, which belongs to the field of tumor immunotherapy. The core of the chimeric antigen receptor T cell of the present invention is to make the T cell express an artificially recombined receptor protein, which is composed of the following fragments in turn: (1) a signal peptide targeting the cell membrane, (2) Anti-CD133 single-chain antibody (scFv), (3) CD28 transmembrane and intracellular segment, (4) CD3ζ chain; the sequence of the part (2) is shown in SEQ ID NO.1. The chimeric antigen receptor T cells of the present invention can specifically recognize and kill CD133+ tumor cells, and play an immunotherapy role, and further optimize it: the chimeric antigen targeting CD133 modified by the switch receptor Recipient T cells can also convert the inhibitory signal of PDL1 into an activating signal, which has a better anti-tumor effect.

Description

technical field [0001] The invention belongs to the field of tumor immunotherapy. Background technique [0002] In recent years, chimeric antigen receptor (CAR) T cell therapy has achieved clinical breakthroughs in leukemia and lymphoma patients. CAR-T cell therapy is to isolate and collect T cells from tumor patients, and genetically modify them in vitro to express chimeric antigen receptors that specifically recognize tumor cells. The modified CAR-T cells are then purified, expanded and activated in vitro, and the CAR-T cells are reinfused into the patient to specifically eliminate tumor cells. Although CAR-T cells have shown significant therapeutic advantages in the treatment of hematological tumors, their efficacy on solid tumors is limited because solid tumors form a special immune microenvironment in the body and solid tumor cells lack tumor-specific antigen targets. Wait. Therefore, it is necessary to find new tumor-specific targets to overcome the obstacles of poo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/28C07K19/00C12N15/13C12N7/01C12N5/10A61K39/00A61P35/00
CPCC07K16/2896C07K14/7051C07K16/2827C12N7/00C12N5/0636A61K39/0011A61P35/00C07K2317/622C07K2319/02C07K2319/03C07K2319/33C12N2510/00C12N2740/15021
Inventor 卢铀尹利梅薛建新仝瑞占
Owner WEST CHINA HOSPITAL SICHUAN UNIV