Construction of broad-host plasmid for inducible expression of green fluorescent protein and application of broad-host plasmid in fluorescent tracing

A green fluorescent protein and induced expression technology, applied in the field of genetic engineering, can solve the problems of degradation, inability to use, incompatibility, etc., achieve strong fluorescence activity, eliminate interference from dead bacteria, and facilitate observation

Pending Publication Date: 2021-09-28
SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Different species of bacteria, such as Escherichia coli, Salmonella, and Brucella, usually construct their own dedicated fluorescent marker plasmids. Although they have significant fluorescent activity when used alone, due to the replication characteristics of the plasmid, the type of promoter Different, different bacteria require different types of plasmids, and the same plasmid cannot be used among different species of bacteria. For example, a plasmid that can express fluorescence in E. Plasmids that can express fluorescence in Lubacteria are not compatible in E. coli and Salmonella
In addition, most of the fluorescent plasmids used in the market for Escherichia coli, Salmonella and Brucella are persistent expression fluorescent plasmids. During the infection process, both dead bacteria and live bacteria can emit fluorescence, which cannot effectively distinguish infected bacteria from live bacteria. or dead bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of broad-host plasmid for inducible expression of green fluorescent protein and application of broad-host plasmid in fluorescent tracing
  • Construction of broad-host plasmid for inducible expression of green fluorescent protein and application of broad-host plasmid in fluorescent tracing
  • Construction of broad-host plasmid for inducible expression of green fluorescent protein and application of broad-host plasmid in fluorescent tracing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Construction of pBT-iEGFP plasmid

[0039] The inducible plasmid pZT-EGFP plasmid (Tian M, Qu J, Bao Y, Gao J, Liu J, Wang S, Sun Y, Ding C, Yu S. Construction of pTM series plasmids forgene expression in Brucella species. J Microbiol Methods, 2016; 123: 18-23.) as a template, iEGFP-F and iEGFP-R as primers, the primers are as follows:

[0040] iEGFP-F: AGGGAACAAAAGCTGGGTACCCCGTTTCCATTTAGGTGGGTA (SEQ ID NO. 2)

[0041] iEGFP-R: CGCGGTGGCGGCCGCTCGATCGATTATTTTATTTCCTG (SEQ ID NO. 3)

[0042] Use the fidelity enzyme PrimeSTAR Max DNA Polymerase (Dalian Bao Biological Co., Ltd.) to perform PCR amplification of the gene fragment TetR-Pzt-1-iEGFP that can induce the expression of green fluorescent protein. The PCR reaction system is 50 µL, including: PrimeSTAR Max Premix (2× ) 25 µL, each 2 µL of upstream primer and downstream primer, 2 µL of pZT-EGFP (5 µg / µL), make up to 50 µL with sterile water; 30 s for 30 cycles. The size of the product was 1908 bp. After...

Embodiment 2

[0045] Example 2 Induced expression of green fluorescent protein by pBT-iEGFP plasmid in Escherichia coli

[0046] Induced expression of green fluorescent protein by pBT-iEGFP plasmid in Escherichia coli engineering strain DH5a

[0047] Take 100 µL Escherichia coli competent cells (Beijing Tiangen Biology), slowly melt on the ice-water mixture, add 20ng pBT-iEGFP plasmid, mix well, ice bath for 30 min, heat shock at 42°C for 90 s, and ice bath for 2 min , add 1 mL of LB solution, shake and incubate at 37 °C for 45 min, spread chloramphenicol on LB plates to screen positive clones, identify positive colonies by PCR, and name the positive bacteria as DH5α(pBT-iEGFP); inoculate DH5α(pBT-iEGFP) on Add 0 ng / mL, 10 ng / mL, 25 ng / mL, 50 ng / mL, and 100 ng / mL anhydrotetracycline to the chloramphenicol LB solution to induce expression for 12 h, take 500 µL of culture solution, and wash twice with PBS. Suspend in sterile water, take 5-10 µL of the suspension to coat glass slides, dry wit...

Embodiment 3

[0053] Example 3 pBT-iEGFP plasmid induces expression of green fluorescent protein in Salmonella typhimurium

[0054] 1. Construction of recombinant bacteria: Salmonella typhimurium SL1344 was inoculated into LB liquid medium, cultured to early logarithmic growth (OD600= 0.4-0.6), ice bathed for 10 min, washed with sterile pre-cooled water twice, Pre-cooled 10% glycerol sterile water to suspend cells, aliquot 100 µL in each tube, add 1 µg pBT-iEGFP plasmid, ice-bath for 10 min, add the mixture to a 1 mm electroporation cuvette, under the condition of 1.8 kV 200 Ω, The plasmid was electrotransformed into Salmonella typhimurium SL1344, chloramphenicol was applied on LB plates to screen positive clones, and PCR was used to identify positive clones. The identified positive strain was named SL1344 (pBT-iEGFP).

[0055] 2. Recombinant bacteria are sensitive to anhydrotetracycline: SL1344(pBT-iEGFP) was inoculated in LB liquid medium, cultured for 12 hours, measured the OD600 value o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses construction of a broad-host plasmid for inducible expression of green fluorescent protein and application of the broad-host plasmid in fluorescent tracing. A pBT-iEGFP plasmid disclosed by the invention is constructed on the basis of a broad-host plasmid pBBR1MCS skeleton, and comprises sequences of a tetracycline repressor protein TetR, a tetracycline promoter Pzt-1 and an enhanced green fluorescent protein EGFP. The broad-host plasmid for inducible expression of green fluorescent protein has the characteristic of broad hosts, can be copied at least in escherichia coli bacteria, salmonella bacteria and brucella bacteria, but is not limited to the escherichia coli bacteria, the salmonella bacteria and the brucella bacteria. Bacteria containing the plasmid can induce host bacteria to emit green fluorescence under the induction condition of anhydrous tetracycline with specific concentration. The broad-host plasmid for inducible expression of green fluorescent protein has the advantages of versatility of multiple bacteria, controllable expression, specific tracing of viable bacteria, strong fluorescence and the like. The plasmid can be used for fluorescence labeling of various bacteria, bacterial morphological observation, fluorescence dynamic tracing and other technologies.

Description

technical field [0001] The present invention belongs to the field of genetic engineering. Specifically, the present invention relates to a method for constructing a broad-host plasmid pBT-iEGFP capable of inducibly expressing enhanced green fluorescent protein. Stable inheritance in bacteria and Brucella malta, under the condition of adding anhydrotetracycline, enhanced green fluorescent protein can be expressed efficiently. This plasmid is constructed based on a broad host plasmid, which can be used for a variety of bacteria, not just for fluorescent tracing of Escherichia coli, Salmonella and Brucella. Background technique [0002] Fluorescent proteins are often used to label and trace specific proteins, luminescent proteins of viruses or bacteria. Compared with fluorescent antibody labeling, they are characterized by low cost, convenient operation, high fluorescence intensity and low background value. At present, there are many proteins used for fluorescent labeling on t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N15/74C07K14/435
CPCC07K14/43595C12N15/70C12N15/74C12N2830/002
Inventor田明星于圣青李子晨王少辉尹伊胡海丁铲李涛祁晶晶
OwnerSHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI