Drug for killing tumor cells with gene mutation as well as preparation method and application of drug

A tumor cell and drug technology, which is applied in the field of gene-killing tumor cell drug and its preparation, can solve the problem of low targeting of tumor gene therapy

Pending Publication Date: 2021-10-22
NANTONG UNIVERSITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to solve the technical problem of low targeting in tumor gene therapy in the prior art, and to provide a drug for killing gene mutation tumor cells and its preparation method and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drug for killing tumor cells with gene mutation as well as preparation method and application of drug
  • Drug for killing tumor cells with gene mutation as well as preparation method and application of drug
  • Drug for killing tumor cells with gene mutation as well as preparation method and application of drug

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0046] A method for preparing a drug for killing gene mutation tumor cells, comprising the following steps:

[0047] S1: Design a pair of CRISPR / Cas9 D10A gRNA for gene editing system;

[0048] In one embodiment, a gRNA with a length of 20 bp is designed according to the DNA sequence of the S45P mutation region of the beta-Catenin gene. see figure 1 , both gRNAs cover the S45P mutation site. Primers were designed to amplify the gRNA with T7 promoter and the DNA fragment of the scaffold (Scaffold) sequence from the all-in-one CRISPR / Cas9 vector.

[0049] The primer sequences used for amplification are as follows:

[0050] Cat-gRNA-F:

[0051] 5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGGCTCCTCCTCTGAGTGGTAAGTTTTTAGAGCTAGAAATAGCAAG-3',

[0052] Cat-gRNA-R:

[0053] 5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG CAGAGGAGGAGCTGTGGTAG GTTTTAGAGCTAGAAATAGCAAG-3',

[0054] The reverse universal primer is: T7-gRNA-R:

[0055] 5'-AAAAAAAGCACCGACTCGGTGCCACTTTTTTC-3'.

[0056] Usin...

Embodiment

[0071] Four gRNAs were designed, and gRNAs were synthesized using an in vitro transcription system. NEB company Cas9 endonuclease was used for in vitro digestion experiment, and the template was the linearized mutant beta-Catenin plasmid pENTR1A-5UTR-Cat(S45P). The results of agarose gel electrophoresis showed that ( image 3 ), the four gRNAs can guide the Cas9 enzyme to cut the template, and obtain fragments with a size of about 3000bp and 2200bp, but the efficiencies are slightly different. A pair of highly efficient gRNAs located in lane 3 and lane 5 were selected for further study, see figure 1 .

[0072] For convenience of comparison, the applicant constructed the eukaryotic expression recombinant plasmid of wild type and mutant beta-Catenin ( Figure 4 A), pCMV-Cat(WT) and pCMV-Cat(S45P), respectively. In order to facilitate the design of the homology arm of the donor, a 669 bp 5'-UTR was inserted between the CMV promoter and the start codon ATG. In order to facili...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides a drug for killing gene mutation tumor cells as well as a preparation method and an application thereof, and relates to the technical field of biomedicine. The drug for killing the gene mutation tumor cells at least comprises recombinant adenoviruses Adv-Cas9D10A-EGFP, Adv-Donor-gRNA and GCV, a Donor sequence in the Adv-Donor-gRNA comprises HSV-TK and Reporter gene, and the Donor sequence in the Adv-Donor-gRNA comprises HSV-TK and Reporter gene. Wherein the Adv-Cas9D10A-EGFP is used for generating two gaps in a DNA chain near a gene mutation site in a tumor cell, the Adv-Donor-gRNA is used for inserting an HSV-TK-Reporter gene sequence into the sheared gaps, and the GCV is used for targeted killing of the gene mutation tumor cell. According to the drug for killing the gene mutation tumor cells, the high targeting property of a CRISPR / Cas9D10A gene editing system and the high killing property of an HSV-TK / GCV suicide gene system are utilized, the HSV-TK gene is accurately inserted into the beta-Catenin tumor cells with S45P mutation, the prodrug GCV is used for killing, death of the cells carrying gene mutation can be effectively induced, and therefore, the purpose of targeted killing of tumor cells is achieved.

Description

technical field [0001] The invention relates to the technical field, in particular to a medicine for killing gene mutation tumor cells and its preparation method and application. Background technique [0002] Human beta-Catenin protein is encoded by CTNNB1 gene, which plays a regulatory and coordinating role in cell adhesion and gene transcription. Beta-Catenin is a subunit of the Cadherin protein complex, so it plays the role of an intracellular signal transduction molecule in the Wnt signaling pathway. Beta-Catenin is expressed in many different tissues in the human body. However, the overexpression or mutation of beta-Catenin is closely related to many cancers, such as hepatocellular carcinoma, colorectal cancer, lung cancer, malignant breast tumor and ovarian cancer. The results of large data analysis of liver cancer genome showed that beta-Catenin mutation is one of the main causes of liver cancer, revealing that CTNNB1 is one of the key driver genes of liver cancer. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K48/00A61K38/45A61K31/522A61P35/00C12N15/861C12N15/90C12N15/55C12N15/54
CPCA61K48/0058A61K48/0008A61K38/45A61K31/522A61P35/00C12N15/86C12N15/907C12N9/22C12N9/1211C12Y207/01021C12N2710/10343C12N2800/107A61K2300/00
Inventor孙伟范义辉冯金荣孙晓雷庄重
OwnerNANTONG UNIVERSITY