CLD protein mutant and applications
A protein mutant and protein technology, applied in the field of genetic engineering, can solve the problems of poor effect of T/F strains, achieve good application prospects, small changes in ability, and improve the effect of neutralization ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Construction of eukaryotic expression vectors pCDNA-C25NDC60S, pCDNA-C30NDC60S, pCDNA-C35NDC60S, pCDNA-C40NDC60S and pCDNA-C45NDC60S
[0026] The primers used in this example are as follows:
[0027] P1-F: GAATTCCCTGCTGCTGCTCCTGCCTCAGGCCCAGGCTGTGAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACCTGTA;
[0028] P1-R: TTAAACGGGCCCTCTAGACTCGAGCTACGCAGGAGGGGGGTTTGGGGTG.
[0029] P2-F: ATGGACCGGGCCAAGCTGCTGCTCCTGCTCCTGCTGCTGCTCCTGCCTCTGCAGATATCCAGCACAGTGG;
[0030] P2-R: GAGGCAGGAGCAGCAGCAGGAGCAGGAGCAGCAGCTTGGCCCGGTCCATGAATTCCACCACACTGGACTAGTGG.
[0031] P3-F:GATCGCGCTGACTCAAGAAGAAGCCCTTTGGGAC;
[0032] P3-R: GTCCCAAAGGCTTCTTCTTGAGTCACGCGCGATC.
[0033] (1) Construction of pCDNA-C25NDC60S:
[0034] PCR was performed using pET28a-C25D (CN 102617738A) as a template with primers P1-F and P1-R, and the gel was recovered after nucleic acid electrophoresis. Use pCDNA3.1 as a template to carry out PCR with primers P2-F and P2-R, and gel recovery after nucleic acid electrophoresis. ...
Embodiment 2
[0049] The recombinant protein CLD mutant expression of each eukaryotic expression vector prepared in embodiment 1:
[0050] 1. Cell culture
[0051] Subculture at a cell density of 600,000-700,000 / ml, with a total volume of 30ml. When the 293F cell density reaches 1.2-1.5 million cells / ml, collect the cells (centrifuge at 1200 rpm for 5min), and resuspend them with 15ml of medium for transfection. dye.
[0052] 2. Transfection:
[0053] The plasmid used for transfection per million cells was 1-1.5 μg; 750 μl normal saline + 37.5 μg plasmid; 750 μl normal saline + 150 μl PEI (1 mg / ml). After mixing separately and standing for 5 minutes, mix and gently mix, let stand at room temperature for 10 minutes (less than 20 minutes), then add the plasmid-liposome mixture into the shaker flask, put it into a shaker after mixing (8% carbon dioxide, 37°C, 125rpm). Add 15ml medium after 4-6h. After 4 days, the cell supernatant was collected, then concentrated by ultrafiltration with a ...
Embodiment 3
[0065] Application of CLD recombinant protein and recombinant protein CLD mutant in the preparation of medicines for treating or preventing HIV-1 virus:
[0066] 1) Preparation of HIV-1 pseudovirus:
[0067]pCDNA3.1(+) plasmids (Centralized Facility for AIDS Reagents) containing different HIV-1 env genes and pSG3 (Centralized Facility for AIDS Reagents) framework plasmids with deletion of HIV-1 env genes were passed through liposomes (Lipofectamine TM 2000, Invitrogen Corporation) co-transfected 293T cells. After 48 hours of transfection, the virus-containing culture medium supernatant was filtered with a 0.45 μm filter membrane and added with 10% volume of fetal bovine serum, then packed into 1.5ml centrifuge tubes and stored at -80°C for preparation; luciferase (commercially available, promega company) to determine the virus titer.
[0068] The different HIV-1env genes contained in the above-mentioned different pCDNA3.1 (+) plasmids are: MSW2, CH811, 700010040.C9.4520, PR...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

