CLD protein mutant and applications

A protein mutant and protein technology, applied in the field of genetic engineering, can solve the problems of poor effect of T/F strains, achieve good application prospects, small changes in ability, and improve the effect of neutralization ability

Active Publication Date: 2021-10-29
CHENGDU VIROGEN BIOPHARMACEUTICAL CO LTD
View PDF15 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Early applicants tried to express CD4 and DC-SIGN in prokaryotic cells after fusion (CN 102617738A), and the results showed that the designed recombinant protein CLD had better antiviral activity, and the tested virus neutralization ability reached microgram level, but the applicant In later experiments, it was found that the recombinant protein was not effective against most T / F strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CLD protein mutant and applications
  • CLD protein mutant and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Construction of eukaryotic expression vectors pCDNA-C25NDC60S, pCDNA-C30NDC60S, pCDNA-C35NDC60S, pCDNA-C40NDC60S and pCDNA-C45NDC60S

[0026] The primers used in this example are as follows:

[0027] P1-F: GAATTCCCTGCTGCTGCTCCTGCCTCAGGCCCAGGCTGTGAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACCTGTA;

[0028] P1-R: TTAAACGGGCCCTCTAGACTCGAGCTACGCAGGAGGGGGGTTTGGGGTG.

[0029] P2-F: ATGGACCGGGCCAAGCTGCTGCTCCTGCTCCTGCTGCTGCTCCTGCCTCTGCAGATATCCAGCACAGTGG;

[0030] P2-R: GAGGCAGGAGCAGCAGCAGGAGCAGGAGCAGCAGCTTGGCCCGGTCCATGAATTCCACCACACTGGACTAGTGG.

[0031] P3-F:GATCGCGCTGACTCAAGAAGAAGCCCTTTGGGAC;

[0032] P3-R: GTCCCAAAGGCTTCTTCTTGAGTCACGCGCGATC.

[0033] (1) Construction of pCDNA-C25NDC60S:

[0034] PCR was performed using pET28a-C25D (CN 102617738A) as a template with primers P1-F and P1-R, and the gel was recovered after nucleic acid electrophoresis. Use pCDNA3.1 as a template to carry out PCR with primers P2-F and P2-R, and gel recovery after nucleic acid electrophoresis. ...

Embodiment 2

[0049] The recombinant protein CLD mutant expression of each eukaryotic expression vector prepared in embodiment 1:

[0050] 1. Cell culture

[0051] Subculture at a cell density of 600,000-700,000 / ml, with a total volume of 30ml. When the 293F cell density reaches 1.2-1.5 million cells / ml, collect the cells (centrifuge at 1200 rpm for 5min), and resuspend them with 15ml of medium for transfection. dye.

[0052] 2. Transfection:

[0053] The plasmid used for transfection per million cells was 1-1.5 μg; 750 μl normal saline + 37.5 μg plasmid; 750 μl normal saline + 150 μl PEI (1 mg / ml). After mixing separately and standing for 5 minutes, mix and gently mix, let stand at room temperature for 10 minutes (less than 20 minutes), then add the plasmid-liposome mixture into the shaker flask, put it into a shaker after mixing (8% carbon dioxide, 37°C, 125rpm). Add 15ml medium after 4-6h. After 4 days, the cell supernatant was collected, then concentrated by ultrafiltration with a ...

Embodiment 3

[0065] Application of CLD recombinant protein and recombinant protein CLD mutant in the preparation of medicines for treating or preventing HIV-1 virus:

[0066] 1) Preparation of HIV-1 pseudovirus:

[0067]pCDNA3.1(+) plasmids (Centralized Facility for AIDS Reagents) containing different HIV-1 env genes and pSG3 (Centralized Facility for AIDS Reagents) framework plasmids with deletion of HIV-1 env genes were passed through liposomes (Lipofectamine TM 2000, Invitrogen Corporation) co-transfected 293T cells. After 48 hours of transfection, the virus-containing culture medium supernatant was filtered with a 0.45 μm filter membrane and added with 10% volume of fetal bovine serum, then packed into 1.5ml centrifuge tubes and stored at -80°C for preparation; luciferase (commercially available, promega company) to determine the virus titer.

[0068] The different HIV-1env genes contained in the above-mentioned different pCDNA3.1 (+) plasmids are: MSW2, CH811, 700010040.C9.4520, PR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, and in particular to a CLD protein mutant and applications. The protein is any of proteins as shown in SEQ ID NO.1-SEQ ID NO.5. Cysteine at a position of CD4 60 in a primary CLD recombinant protein is mutated into serine by the applicant. The inhibition capacity of the obtained CLD protein mutant on a tested HIV-1 strain is improved by 2-3 orders of magnitude. Therefore, the neutralizing capacity on the virus is remarkably improved, such a difference is more remarkable in the tested HIV-1 T / F (transformer / founder) virus; the CLD protein can greatly improve the binding efficiency with the HIV-1 virus; and a compound formed by the CLD protein mutant or the recombinant CLD protein and the envelope protein can be used as an immunogen, so that an antibody aiming at the envelope protein V1V2 region can be better induced, so as to achieve a good application prospect.

Description

technical field [0001] The invention relates to the field of genetic engineering, more specifically to a CLD protein mutant and its application. Background technique [0002] Human immunodeficiency virus (HIV-1) is the pathogen of AIDS (AIDS, acquired immunodeficiency syndrome). Due to the high variability of HIV-1 and the lack of understanding of the mechanism of human immunity, no successful HIV-1 vaccine has been developed yet. The treatment and prevention of HIV-1 infection mainly depend on anti-HIV drugs. However, due to the high variability of HIV-1, long-term use of clinical drugs will inevitably lead to viral resistance and drug resistance. The development of novel antiviral drugs is urgent for the sustainability of HIV-1 treatment. [0003] The target cell types infected by HIV-1 include T cells, macrophages and some types of DC cells, whose common feature is the expression of CD4 molecules and co-receptor molecules on the cell surface. According to whether HIV-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00A61K38/17A61K39/21A61P31/18
CPCC07K14/70514C07K14/7056A61K38/1774A61K38/178A61K39/12A61P31/18C07K2319/00A61K38/00C12N2740/16134A61K2300/00C07K14/162C07K14/005
Inventor胡勤学付明杜涛
OwnerCHENGDU VIROGEN BIOPHARMACEUTICAL CO LTD