Application of nuclear membrane protein knock-down in stem cell transplantation
A technology of stem cells and neural stem cells, applied in the field of stem cell transplantation, can solve the problems of carcinogenesis and limited regulation methods, and achieve the effects of promoting differentiation, improving nervous system diseases, and inhibiting carcinogenesis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0055] Embodiments of the invention are described in detail below, examples of which are illustrated in the accompanying drawings. The embodiments described below by referring to the figures are exemplary only for explaining the present invention and should not be construed as limiting the present invention.
[0056] The present invention adopts the following technical solutions for solving the problems of the technologies described above:
[0057]A kind of application of nuclear envelope protein knockdown in stem cell transplantation, comprising the following steps:
[0058] Step 1), designing 2 pairs of siRNA primers against nuclear membrane proteins online, constructing lbr-shRNAi-1 and lbr-shRNAi-2 lentiviral vectors;
[0059] 11), online design 2 pairs of siRNA primers for nuclear membrane proteins, the sequences are respectively SEQ ID No.1: CAGCTTTACACTGTGAAGTAT and SEQ ID No.2: CACCAGAGGACCTGTACCTTT, and synthesize related primers;
[0060] 12), the annealing of the ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com