Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of nuclear membrane protein knock-down in stem cell transplantation

A technology of stem cells and neural stem cells, applied in the field of stem cell transplantation, can solve the problems of carcinogenesis and limited regulation methods, and achieve the effects of promoting differentiation, improving nervous system diseases, and inhibiting carcinogenesis

Pending Publication Date: 2021-11-16
NANTONG UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the proliferative ability of neural stem cells is strong, and there is a serious risk of carcinogenesis. At present, the means of regulating it are still very limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of nuclear membrane protein knock-down in stem cell transplantation
  • Application of nuclear membrane protein knock-down in stem cell transplantation
  • Application of nuclear membrane protein knock-down in stem cell transplantation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0055] Embodiments of the invention are described in detail below, examples of which are illustrated in the accompanying drawings. The embodiments described below by referring to the figures are exemplary only for explaining the present invention and should not be construed as limiting the present invention.

[0056] The present invention adopts the following technical solutions for solving the problems of the technologies described above:

[0057]A kind of application of nuclear envelope protein knockdown in stem cell transplantation, comprising the following steps:

[0058] Step 1), designing 2 pairs of siRNA primers against nuclear membrane proteins online, constructing lbr-shRNAi-1 and lbr-shRNAi-2 lentiviral vectors;

[0059] 11), online design 2 pairs of siRNA primers for nuclear membrane proteins, the sequences are respectively SEQ ID No.1: CAGCTTTACACTGTGAAGTAT and SEQ ID No.2: CACCAGAGGACCTGTACCTTT, and synthesize related primers;

[0060] 12), the annealing of the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of nuclear membrane protein knock-down in stem cell transplantation, which specifically comprises the following steps: 1) designing two pairs of siRNA primers aiming at nuclear membrane protein on line, and constructing a lentiviral vector; (2) intervening proliferation and differentiation of the neural stem cells by in-vitro lentivirus-mediated nuclear membrane protein knock-down; and 3), intervening proliferation and differentiation of the neural stem cells by in-vivo lentivirus-mediated nuclear membrane protein knock-down. According to the invention, LBR (nuclear membrane protein) is used for inhibiting division of stem cells and promoting differentiation of the stem cells; neural stem cells may have strong division ability after transplantation, and have potential carcinogenicity. After the nuclear membrane protein is knocked down, the cell division capability is obviously reduced so that the method can be widely used for solving the carcinogenicity problem caused by stem cell transplantation.

Description

technical field [0001] The invention relates to the application of nuclear envelope protein knockdown in stem cell transplantation, and belongs to the field of stem cell transplantation. Background technique [0002] Stem cell transplantation has become an important topic in the field of regeneration, but it has obvious cancer risk. Common approaches include (i) chemotherapy, (ii) gene therapy, and (iii) immunotherapy. Immunotherapy has defects such as high cost, batch-to-batch variability, non-specific antibody binding, and large side effects. The treatment efficiency of chemical small molecules is relatively low, and it is difficult to meet the clinical needs at present. Gene therapy usually targets reprogramming transcription factors. However, modification of reprogramming factors can easily lead to serious damage to the cell state, which is not conducive to stem cell differentiation. [0003] After central nervous system injury, in addition to the neuron death directl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867C12N15/66C12N5/10G01N33/68
CPCC12N15/113C12N15/86C12N15/66C12N5/0623C07K14/47G01N33/68C12N2310/14C12N2510/00C12N2501/11C12N2501/115C12N2740/15043G01N2333/47
Inventor 邢玲燕王家琪袁卉华陈罡
Owner NANTONG UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More