Gene editing method and system for mycobacterium neoaurum engineering bacteria

A mycobacterium, gene editing technology, applied in the field of genetic engineering, can solve the problems of long cycle, difficult screening, low recombination efficiency of new Mycobacterium aureus, etc., and achieve the effect of high gene mutation rate and reduced toxicity

Pending Publication Date: 2022-02-25
ZHEJIANG UNIV OF TECH
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional homologous recombination technology can realize the knockout and integration of these genes, but due to the low self-recombination efficiency of Mycobacterium aureus (10 -6 ~10 -5 ), the use of this technology has many problems such as complicated operation, long cycle, difficult screening, low efficiency, etc.
In recent years, CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats, Clustered Regularly Interspaced Short Palindromic Repeats) technology has also been introduced into the gene knockout of Mycobacterium aureus, which can precisely implement DNA editing, but is limited Due to DNA double-strand breaks affecting growth, homologous and non-homologous repair efficiency is low, large fragment knockout disrupts the expression of adjacent genes, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene editing method and system for mycobacterium neoaurum engineering bacteria
  • Gene editing method and system for mycobacterium neoaurum engineering bacteria
  • Gene editing method and system for mycobacterium neoaurum engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1: Construction of single base editing plasmid pMV261-rAPOBEC / n(d)Cas9 / UGI(pBE)

[0055] (1) Linearization of plasmids and acquisition of insert fragments

[0056] For the linearization of plasmid pMV261, use pMV-F1: 5'-CCATTGCGAAGTGATTCCTCCGG-3', pMV-R1: 5'-GTTAACTAGCGTACGATCGACTGCC-3' as primers, PCR amplification and gel electrophoresis verification (see attached Figure 5 ), and adding 0.5 μL DpnI 37 ° C ~ 2 h to digest the template, the product was purified and recovered.

[0057] rAPOBEC (nucleotide sequence such as SEQ ID NO:1), UGI (nucleotide sequence such as SEQ ID NO:2) and n(d)Cas9 (nucleotide sequence such as SEQ ID NO:3, SEQ ID NO:4 ) The three genes were obtained by gene synthesis, and inserted into the multiple cloning site of the pET28a plasmid, and stored in Escherichia coli DH5α.

[0058] 提取pET28a-rAPOBEC,pET28a-UGI,pET28a-nCas9和pET28a-dCas9质粒作为模板,用引物APO-F:GGAGGAATCACTTCGCAATGGATGTCGTCGGAGACCGGCCCC和APO-R:ggactccggggtggcggactccgaggtgcccggggtc...

Embodiment 2

[0061] Example 2: Construction of single base editing plasmids pTarget-sgRNA, pTarget-sgRNA_(kshA1-1), pTarget-sgRNA_(kshA1-2), pTarget-sgRNA_(kshA2)

[0062] (1) Linearization of plasmids and acquisition of insert fragments

[0063]Obtain the pTarget plasmid backbone (nucleotide sequence such as SEQ ID NO: 7) by gene synthesis, which contains the OriMe replicon (nucleotide sequence such as SEQ ID NO: 8) capable of independently replicating in mycobacteria, hygromycin Resistance gene Hyg (nucleotide sequence such as SEQ ID NO: 9) and Escherichia coli replicon OriE (nucleotide sequence such as SEQ ID NO: 10), preserved in Escherichia coli DH5α, cultivated and extracted in LB to obtain plasmid pTarget . Using pT-F: AGACTCGAGTCTAGAGTTTAAACAGTATTAAACGC and pT-R: AAATAAAACGAAAGGCTCAGTCGAAAGACT as primers, PCR amplification and gel electrophoresis verification (see attached Figure 5 ), and 0.5 μL DpnI was added to digest the template at 37° C. for 2 h, and the product was purifie...

Embodiment 3

[0069] Example 3: Application of single base editing system

[0070] The constructed pBE and pBEd plasmids were respectively electrotransformed into Mycobacterium aureus, in Kan r Positive transformants were screened on the plate, colony PCR and sequencing primers were pMV-F2 and pMV-R2, and the correct transformants were verified to be transferred to 5mL liquid LB (Kan r ), shake culture at 30℃~180rpm for 3 days, then transfer 2% to 50mL LB (Kan r ) at 30° C. to 180 rpm for the preparation of electroporation competence to obtain Mn-pBE and Mn-pBEd competence.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene editing method and a system of mycobacterium neoaurum engineering bacteria, and belongs to the technical field of gene engineering. The gene editing system disclosed by the invention comprises a pMV261-rAPOBEC / n (d) Cas9 / UGI plasmid and a pTarget-sgRNA plasmid, the pMV261-rAPOBEC / n (d) Cas9 / UGI plasmid can perform fusion expression on Cas9 protein losing cleavage activity, cytosine deaminase and a uracil glycosidase inhibitor, under the guidance of sgRNA, cytosine (C) in a sequence N20 fragment can be subjected to a deamination reaction at a targeted target gene, the cytosine (C) is converted into uracil (U), and in the subsequent replication process, thymine (T) is changed to form TAG, TGA and TAA termination codons, so that the purpose of silencing or interrupting the normal reaction of the target gene is achieved. The system is low in toxicity to hosts, specific editing can be achieved, passage is stable, and the highest editing efficiency can reach 50%.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method and system for gene editing of novel Mycobacterium aureus engineering bacteria. Background technique [0002] There are more than 300 kinds of steroid drugs approved for marketing, and they are one of the most important drugs used by humans to treat diseases. Its market demand is huge, and its production scale is increasing year by year. This trend is attributed to its wide range of therapeutic uses. Steroids are mainly divided into two classes, sex hormones and adrenocortical hormones. Among them, sex hormones include male hormones, estrogens, etc., which can be used to treat male sexual organ dysfunction, gynecological diseases, and contraception. Adrenal corticosteroids include glucocorticoids, mineralocorticoids, etc., and can be used to treat symptoms such as inflammation, rheumatoid arthritis, and shock. In addition, steroid drugs are als...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/74C12N15/55C12N15/113C12N15/53C12N1/21C12R1/32
CPCC12N15/74C12N15/1137C12N9/22C12N9/0073C12Y114/13142C12N2310/20C12N2800/101Y02A50/30
Inventor柳志强王鑫鑫柯霞郑裕国
OwnerZHEJIANG UNIV OF TECH