Irpex lacteus and application of Irpex lacteus in degradation of waste branches in orchard
A technology of white sac rake tooth bacteria and branches, applied in the field of microorganisms, can solve the problems of low cellulose utilization rate and slow operation time, and achieve the effects of improving vitality, promoting degradation, and high degradation efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0085] Isolation, identification, preservation of the strain of embodiment 1
[0086] 1. Separation
[0087] A strain of bacteria was isolated from the trunks of peach trees in Luyuan Landscape Scenic Area, Huiji District, Zhengzhou, Henan, and named SDAU-B.
[0088] 2. Identification
[0089] 1. Morphological identification
[0090] The colonies of strain SDAU-B were white, thin, slightly raised cotton flocs, with some dense tufted and feathery aerial mycelium radially arranged on the entire surface of the colony.
[0091] 2. Molecular biological identification
[0092] SDAU-B was subjected to ITS sequencing, and SDAU-B was identified as A. albicans. The ITS sequence (SEQ ID NO: 1) is as follows:
[0093] TGTGCTTTGACGGGTTGTAGCTGGCCTCTCACGAGGCATGTGCACGCCTGGCTCATCCACTCTTAACCTCTGTGCACTTTATGTAAGAGAAAAAAATGGTGGAAGCTTCCAGGATCTCGCGAGAGGTCTTCGGTTGAACAAGCCGTTTTTCTTTCTTATGTTTTACTACAAACGCTTCAGTTATAGAATGTCAACTGTGTATAACACATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAA...
Embodiment 2
[0097] 1. Test method
[0098] 1.1 Determination of lignocellulose degradation ability
PUM
| Property | Measurement | Unit |
|---|---|---|
| Thickness | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


