Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Irpex lacteus and application of Irpex lacteus in degradation of waste branches in orchard

A technology of white sac rake tooth bacteria and branches, applied in the field of microorganisms, can solve the problems of low cellulose utilization rate and slow operation time, and achieve the effects of improving vitality, promoting degradation, and high degradation efficiency

Active Publication Date: 2022-03-18
SHANDONG AGRICULTURAL UNIVERSITY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Before microorganisms can utilize cellulose, it must be released from lignin and hemicellulose packages, resulting in low cellulose utilization and slow hands-on times

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Irpex lacteus and application of Irpex lacteus in degradation of waste branches in orchard
  • Irpex lacteus and application of Irpex lacteus in degradation of waste branches in orchard
  • Irpex lacteus and application of Irpex lacteus in degradation of waste branches in orchard

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Isolation, identification, preservation of the strain of embodiment 1

[0086] 1. Separation

[0087] A strain of bacteria was isolated from the trunks of peach trees in Luyuan Landscape Scenic Area, Huiji District, Zhengzhou, Henan, and named SDAU-B.

[0088] 2. Identification

[0089] 1. Morphological identification

[0090] The colonies of strain SDAU-B were white, thin, slightly raised cotton flocs, with some dense tufted and feathery aerial mycelium radially arranged on the entire surface of the colony.

[0091] 2. Molecular biological identification

[0092] SDAU-B was subjected to ITS sequencing, and SDAU-B was identified as A. albicans. The ITS sequence (SEQ ID NO: 1) is as follows:

[0093] TGTGCTTTGACGGGTTGTAGCTGGCCTCTCACGAGGCATGTGCACGCCTGGCTCATCCACTCTTAACCTCTGTGCACTTTATGTAAGAGAAAAAAATGGTGGAAGCTTCCAGGATCTCGCGAGAGGTCTTCGGTTGAACAAGCCGTTTTTCTTTCTTATGTTTTACTACAAACGCTTCAGTTATAGAATGTCAACTGTGTATAACACATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAA...

Embodiment 2

[0097] 1. Test method

[0098] 1.1 Determination of lignocellulose degradation ability

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Thicknessaaaaaaaaaa
Login to View More

Abstract

The invention discloses Irpex lacteus and application thereof in degradation of waste branches in orchards, and relates to the technical field of microorganisms. The Irpex lacteus SDAU-B disclosed by the invention is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.23855, the preservation date is November 17, 2021, and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The Irpex lacteus provided by the invention has the capability of degrading lignin and cellulose, can improve the activity of degrading enzyme in waste piles, can play a degrading role to promote the increase of the content of ammonium nitrogen in the piles, and can improve the degradation efficiency of waste branches in orchards.

Description

technical field [0001] The invention relates to the technical field of microbes, in particular to a strain of Racula albicans and its application in degrading waste branches in orchards. Background technique [0002] The orchard produces a large amount of waste such as litter and leaves every year. Due to unreasonable treatment, the discarded fruit tree branches are directly discarded in the garden or simply burned, which not only affects the appearance of the orchard and wastes resources, but also provides a habitat for orchard pests. It becomes a source of infection for orchard diseases and pests, and burning branches also directly causes harm to the environment. [0003] The refractory part of orchard waste is mainly the discarded branches of the orchard, and the main component of the branches is lignocellulose. Under natural conditions, due to its special physical structure and chemical composition, lignocellulose is water-insoluble and biologically resistant, so it is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/14C05F15/00C05F17/20C12R1/645
CPCC12N1/14C05F3/00C05F17/20C05F5/002C05F11/00Y02W30/40
Inventor 刘会香郝丽琴邹玉于成明张庆霞陈荣熊雄李杰
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com