Colibacillus plasmid vector and its application method

A plasmid vector, Escherichia coli technology, applied in the field of genetic engineering

Inactive Publication Date: 2005-04-27
NANJING NORMAL UNIVERSITY
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, T7 expression vectors also have shortcomings, such as relying on auxiliary genes, needing to take other measures to control the background expression level, and easily producing insoluble expression products, etc. (Russell D.1999. Gene expression systems based on bacteriophage T7 RNA polymerase.In GeneExpression Systems (Fernandez, JM, and JP Hoeffler, eds.), pp 9-44. Academic Press, London)
At the same time, because people use lac or P L promoters, so there are also issues with inducers or methods of induction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Colibacillus plasmid vector and its application method
  • Colibacillus plasmid vector and its application method
  • Colibacillus plasmid vector and its application method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] (1) Design and synthesis of promoters and terminators:

[0040] According to E. coli σ 32 Design a new type of promoter based on the base common sequence of the recognized promoter, whose sequence is 5'- CCCCC TTGAATGTGGGGGAA ACAT CCCC AT GATCCAAGGA G-3' (underlined part is the common sequence), named heat shock promoter (Hshpromoter, figure 1 ); According to the GeneBank file ECORPSRPO, design a GAAA terminator independent of Escherichia coli Rho, its sequence is 5'-GA AG GCCGCTTCC GAAA GGAAGCGGC T TTTTT-3' (the underline indicates the paired stem-loop sequence in the terminator), named heat shock terminator (Hsh terminator, figure 1 ).

[0041] (2) Amplification and assembly method of each element of the plasmid vector:

[0042] Design and synthesize a pair of primers with a novel promoter or terminator, their sequence is: 5'-CCG GAATTC CTCCTTGGATC ATGGGGATGTTTCCCCCACATTCAAGGGGG CTCTTCCGCT TCCTCTC -3' and 5'-TGAAGCTTGAAGGCCGCTTC CGAAAGGAAG CGGCTTTTTT ...

Embodiment 2

[0048] Embodiment 2: basically the same as Example 1, the difference is that the promoter is the promoter of Escherichia coli heat shock protein gene lon, and its sequence is 5'-CGGCGTTGAA TGTGGGGGAA ACATCCCCAT ATACTGACGTA-3'(lon), designed with The primers of lon heat shock protein promoter were amplified by DNA polymerase Pyrobest, phosphorylated by T4 DNA kinase and circularized by T4 DNA ligase to obtain a new vector pHsh-lon.

Embodiment 3

[0049] Embodiment 3: substantially the same as Example 1, the difference is that the promoter is the promoter of the Escherichia coli heat shock protein gene dnaK P1, and its sequence is 5'-CCCCCTTGAT GACGTGGTTT ACGACCCCAT TTAGTAGTCA-3' (dnaK P1), the design band The primers with dnaK P1 heat shock protein promoter were amplified by DNA polymerase Pyrobest, phosphorylated by T4 DNA kinase and circularized by T4 DNA ligase to obtain a new vector pHsh-dK.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to plasmid vector capable of being used in gene recombinant technology, and the method of utilizing the plasmid vector in expressing target gene. The plasmid vector of the present invention features that it has colibacillus sigma factor sigma32 distinguished and regulated promoter. The method of utilizing the plasmid vector in expressing target gene includes inserting the expression vector gene into one of the plasmid vector of the present invention, transforming colibacillus host cell with the obtained recombinant plasmid and inducing the expression of the target gene in heat shock inducing method during the culture. The bioactive protein gene expression of the present invention has the advantages of low background expression, high recombinant protein yield, no use of chemical inducing agent, easy molecular operation, and no need of special gene reformation of host strain.

Description

technical field [0001] The present invention relates to the field of genetic engineering, specifically, to a plasmid vector that can be used in gene recombination technology and its application method, more specifically, to a plasmid vector regulated by the Escherichia coli heat shock system, and to using the plasmid vector to express A method for producing a target protein from an exogenous gene. Background technique [0002] Escherichia coli expression system consists of two parts: expression vector and corresponding host cells. It is the earliest, most widely used and easiest-to-operate high-efficiency gene expression system. In the E. coli expression system, expression vectors usually use regulatable promoters to control the expression of foreign genes; the types of these promoters are important for controlling the inhibition of cell growth by the expressed target protein and reducing the degradation of the target protein by cellular proteases , and the yield and solubi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70
Inventor邵蔚蓝吴华伟
OwnerNANJING NORMAL UNIVERSITY