Recombinant protein and recombinant gene capable of preventing and curing I type diabetes mellitus through immunity

A recombinant protein and diabetes technology, applied in the field of recombinant protein, can solve the problems that polypeptide vaccines cannot enhance immunogenicity and cannot be used in human body

Inactive Publication Date: 2005-09-07
CHINA PHARM UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Many commonly used adjuvants, such as Freund's complete adjuvant and Freund's incomplete adjuvant, can only be used in animals and cannot be used in humans; the only adjuvant available to humans is aluminum adjuvant, and this adjuvant is often harmful to human body. Peptide vaccines cannot enhance immunogenicity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein and recombinant gene capable of preventing and curing I type diabetes mellitus through immunity
  • Recombinant protein and recombinant gene capable of preventing and curing I type diabetes mellitus through immunity
  • Recombinant protein and recombinant gene capable of preventing and curing I type diabetes mellitus through immunity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1 Design, synthesis and cloning of HSP65-P277 polypeptide gene

[0056] According to the amino acid sequences of the MT-HSP65 gene and the P277 polypeptide gene, four oligonucleotide fragments were designed with the aid of a computer by selecting codons favored by Escherichia coli. First, the P277 polypeptide gene was synthesized by PCR method, the gene was cloned into the C-terminus of the L-ansB-C gene of pED, and transformed into Escherichia coli to obtain a recombinant plasmid named pED-P277. Using the pET28a-HSP65 plasmid as a template, the MT-HSP65 gene was obtained by PCR, and the gene was replaced by the L-ansB-C gene in pED-P277, and transformed into Escherichia coli to obtain a recombinant plasmid named PED-HSP65-P277. The specific method is as follows:

[0057] 4 oligonucleotides:

[0058] P1: 5'GCTGGATCCAGTTCTGGGTGGTGGCGTTGCTCTGCTGCGCGTTATCCCGGCTCTGG3'

[0059] P2: 5'GTCAAGCTTAATCTTCGTTAGCCGGGGTCAGGGAGTCCAGAGCCGGGATAACGCGC 3'

[0060] P3: 5’TTG ACC...

Embodiment 2

[0064] Example 2 Expression of HSP65-P277 gene in Escherichia coli

[0065] The recombinant plasmid pED-HSP65-P277 was transformed into Escherichia coli BL21. Pick single bacterium colony and inoculate containing 50ug / ml kanamycin LB liquid culture medium from growing different transformant plates, cultivate overnight at 37 DEG C of constant temperature shaking, transfer and inoculate into fresh corn steep liquor liquid culture medium by 1% ratio ( 50ug / ml kanamycin), after culturing at 37°C for 4 hours, adding α-lactose at a final concentration of 0.5mmol / L to induce E. coli to express T 7 RNA polymerase, continue to culture to express the fusion protein HSP65-P277. After induction, a small amount of bacterial liquid was taken every 1 hour, and the bacterial cells were recovered by centrifugation. SDS-PAGE electrophoresis and thin-layer scanning showed that the fusion expression of the HSP65-P277 polypeptide gene had been realized. The fusion protein reached a stable maximu...

Embodiment 3

[0066] Example 3 Separation and Purification of Recombinant Protein HSP65-P277

[0067] The engineered bacteria after induced expression were collected by centrifugation, suspended in the cell lysate (pH 8.0, 50mM phosphate buffer, 0.02% lysozyme), stirred at 37°C for 30 minutes, and DNase was added to digest the DNA Until the solution is not viscous, the supernatant is recovered by centrifugation, and ammonium sulfate is used for fractional precipitation. The target protein is mainly in the 35%-45% ammonium sulfate precipitation, as shown in Figure 5. The precipitated fusion protein was redissolved in pH 7.4 phosphate buffer, dialyzed for desalting, and after centrifugation, the supernatant was taken for anion exchange column chromatography, DEAE cellulose DE-52 column (2×60cm), using PBS / NaCl gradient Elution, fractional collection for SDS-PAGE electrophoresis detection, HSP65-P277 in the elution peak at 120-150mmol NaCl, check the purity of the prepared samples by SDS-PAGE ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides one kind of restructuring protein and its restructuring gene for preventing and treating type-1 diabetes. Connecting heat shock protein HSP60 originated Mycobacterium bovine to a piece of antigen epitope P277 from human HSP60; restructuring protein produced can be used for immunity directly with no adjuvant. The restructuring protein can stimulate body to produce antigen for P277 both by ways of injection and mucous membrane immunity, decreases marked NOD mouse diabetes occur, can contribute to preventing and caring type-1 diabetes. Meantime, the restructuring gene produced in this invention can also be used to transgene animals or plants and restructuring microorganism as the factory for producing restructuring protein or preparing oral vaccine.

Description

technical field [0001] In the field of medicine, vaccines can be used to prevent autoimmune diseases. The invention is a recombinant protein, which can be used to prevent and treat the occurrence of type I diabetes. Background technique [0002] Type I diabetes, or insulin-dependent diabetes mellitus (IDDM), is an autoimmune disease with familial heredity, and the majority of patients are adolescents. The main manifestations are the destruction of most of the islet β cells and the absolute lack of insulin. At present, there is no effective treatment, and patients need to rely on insulin for life, which is very painful. After 1992, according to the WHO Diamond Project, some regions in my country investigated the incidence of IDDM among children under 15 years of age under unified methods and standards. During 1995, the annual incidence rate of IDDM in children in my country was 0.19 / 100,000 to 1.26 / 100,000, and the annual incidence rate in most areas was 0.5 / 100,000 to 0.9 / 1...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/395A61P3/10C12N15/09C12N15/62
Inventor刘景晶朱爱华金亮曹荣月吴洁
OwnerCHINA PHARM UNIV