Method for rapid construction of carrier for gene targeting recombination

A technology of gene targeting and carrier, which is applied in the frontier fields of molecular biology and genetics, can solve the problems of limiting gene knockout flexibility, health hazards of workers, labor and so on, and achieve simplified assembly steps, reliable fidelity, and reduced false positives. The effect on the production of positive clones

Inactive Publication Date: 2006-10-11
NANJING UNIV
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the limitation of the traditional method is not limited to the time. More importantly, the restriction endonuclease sites at both ends of the target gene to be knocked out have great chance, and the same endonuclease cannot be used for each part. As a result, there is very little room for choice in the experimental operation, which not only increases the difficulty of the experiment, but also limits the flexibility of gene knockout, making it mo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapid construction of carrier for gene targeting recombination
  • Method for rapid construction of carrier for gene targeting recombination
  • Method for rapid construction of carrier for gene targeting recombination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Vector Construction of HRPT2 Conditional Knockout Mice

[0034] HRPT2 is a tumor suppressor gene discovered and cloned in recent years, and the protein encoded by it is called Parafibromin. Mutations in the HRPT2 gene cause parathyroid neoplasia syndrome in humans. However, the physiological function of this gene is still unclear. The construction of HRPT2 conditional knockout mice is an effective means to study its normal physiological functions. In the experimental design, we plan to knock out the second exon of the gene, so as to cause a frame shift during gene translation and cause the encoded protein to be invalid. In this experiment, the 5' homology arm, the 3' homology arm, and the second exon were obtained by PCR amplification. The primers are as follows: 5' homology arm forward primer 5'-GGGG ACAACTTTGTATAGAAAAGTTG CAGTACAACATCCAGAAG-AAGGAGA-3′, reverse primer 5′-GGGG- ACTGCTTTTTTGTACAAACTTG GT-GCTTGAGATCAACTGCAGAGAC-3'. 3' homology arm forwar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method of rapid construct vector by aid of Gateway clone system used for gene-shooting-target recombination, Firstly, by using special designing PCR primer for PCR amplification to obtain 5' and 3' homologous arms that use in homologous recombination, insert the homologous arms in vector pDONRP4-P1R and pDONRP2R-P3 individually by BP recombination reaction; then, inserting the target fragment to intermediate vector pDONR loxP/MCS/loxP- FRT/NEO/FRT that we construct creativity; finally, after one hour fast LR recombination reaction of the 3 vectors showing above and pDEST R4-R3TK vector mixture, the 5' homologous arm, the intermediate fragment, 3' homologous arm and the TK subtractive screen selecting element will split joint according to the designing sequence, by transformation and purification, shoot target gene vector will obtained. The method has the advantage of rapid, flexible, timesaving and labor saving, and the method break-through the controlling of endoenzyme site distribution in traditional method. The method has significant in study of gene function.

Description

1. Technical field [0001] The invention relates to the frontier fields of molecular biology and genetics, and is a fast, flexible and convenient method for constructing a vector for gene targeting and recombination invented by creatively transforming the Gateway recombination reaction system derived from λ bacteriophage. 2. Technical background [0002] The completion of the Human Genome Sequencing Project is not only a great achievement in the field of biology in recent decades, but also poses new challenges to biological workers. Since the genome sequence cannot directly deduce how the RNA and protein encoded by the genome integrate with each other to perform functions such as cell growth, development, and differentiation, so as to form the shape, physiology, and behavior of the entire human body, the main tasks of the post-genome era are both research and development. Elucidate the function of tens of thousands of genes. However, due to the complexity of human physiologi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/63
Inventor 孔冬高翔王鹏飞章念郑斌
Owner NANJING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products