Method for rapid construction of carrier for gene targeting recombination
A technology of gene targeting and carrier, which is applied in the frontier fields of molecular biology and genetics, can solve the problems of limiting gene knockout flexibility, health hazards of workers, labor and so on, and achieve simplified assembly steps, reliable fidelity, and reduced false positives. The effect on the production of positive clones
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Vector Construction of HRPT2 Conditional Knockout Mice
[0034] HRPT2 is a tumor suppressor gene discovered and cloned in recent years, and the protein encoded by it is called Parafibromin. Mutations in the HRPT2 gene cause parathyroid neoplasia syndrome in humans. However, the physiological function of this gene is still unclear. The construction of HRPT2 conditional knockout mice is an effective means to study its normal physiological functions. In the experimental design, we plan to knock out the second exon of the gene, so as to cause a frame shift during gene translation and cause the encoded protein to be invalid. In this experiment, the 5' homology arm, the 3' homology arm, and the second exon were obtained by PCR amplification. The primers are as follows: 5' homology arm forward primer 5'-GGGG ACAACTTTGTATAGAAAAGTTG CAGTACAACATCCAGAAG-AAGGAGA-3′, reverse primer 5′-GGGG- ACTGCTTTTTTGTACAAACTTG GT-GCTTGAGATCAACTGCAGAGAC-3'. 3' homology arm forwar...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com