Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fast inspection reagent kit for streptococcus suis 2-type triple PCR

A detection kit, Streptococcus suis technology, applied in the biological field, can solve the problems of poor specificity and accuracy

Inactive Publication Date: 2007-01-17
ZHEJIANG UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are also problems of poor specificity and accuracy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fast inspection reagent kit for streptococcus suis 2-type triple PCR
  • Fast inspection reagent kit for streptococcus suis 2-type triple PCR
  • Fast inspection reagent kit for streptococcus suis 2-type triple PCR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] The solution of the present invention will be described in more detail below.

[0030] 1. Composition of cryotubes

[0031] Tube A is freeze-dried powder, containing 10×buffer (commercially available), dNTP (commercially available); primers (sequence designed by the inventor, see Table 1) gdh-1, gdh-2, mrp-1, mrp-2, cps2J-1, cps2J-2; Taq DNA polymerase (commercially available). Store at -20°C.

[0032] target gene

Primer

Primer sequence

gdh

gdh-1(20bp)

gdh-2 (20bp)

GCTGCGTATTCTGTCAAACG

CGATGGACAGATAAAGATGG

mrp

mrp-1 (23bp)

mrp-2 (21bp)

GGTATACCTTGCTGGTACGGTTC

AGTCTCTACAGCTGTAGCTGG

cps2J

cps2J-1(20bp)

cps2J-2 (21bp)

TGAGTCCTTATACCACCTGTT

AGAAAATTCATATTGTCCACC

[0033] Tube B contains 1.62mL of lysis buffer solution and is stored at -20°C.

[0034] Tube C contains 0.5mL solution, which is a positive control substance, and is stored at -20°C.

[0035] Tube D contai...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The triplex PCR-based rapid detection kit for Streptococcus suis Type 2 which is composed of four cryopreservation tubes containing different components, 100 PCR reaction tubes and the brochure of the detection steps for the cryopreservation tubes. The four cryopreservation tubes contain mixture of 10*buffer, dNTP, primer gdh-1, gdh-2, mrp-1, mrp-2,cps2J-1, cps2J-2 and Taq DNA polymerase; lysis buffer; positive control solution; diluent respectively. The triplex PCR process established in the present invention can amplify gene gdh, mrp and cps2J of SS-2 at the same time and has high specificity. The homology of sequencing is always between 98.84% and 100% exhibiting high accuracy and specificity.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to the diagnosis of animal diseases, in particular to a rapid detection kit suitable for SS-2 in the pure culture of suspected Streptococcus suis type 2 (SS-2) and tissue samples, i.e. suis chain Coccus Type 2 Triple PCR Rapid Detection Kit. Background technique [0002] Streptococcus suis (SS) can be divided into 35 serotypes according to the difference of capsular antigens, namely 1-34 and 1 / 2. Among them, Streptococcus suis type 2 (SS-2) not only has the characteristics of strong pathogenicity and wide prevalence, but also can cause human infection and death. As early as 1968, Denmark reported the first case of meningitis caused by human infection with Streptococcus suis. In my country, SS-2 infection occurred successively in Jiangsu Province in 1998-1999 and in Sichuan Province in 2005, leading to the death of pigs and humans. The rising trend of suis streptococcal infection and its...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 方维焕李肖梁陈健舜田国明马有智
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com