Double function infusion protein for thrombolysis and anticoagulation , its preparation method and uses

A dual-efficiency, fusion protein technology, applied in chemical instruments and methods, peptide/protein components, animal/human proteins, etc., can solve problems such as adverse effects of curative effect stability

Inactive Publication Date: 2007-05-30
CHINA PHARM UNIV
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the presence of many interfering components in the body, whether such a fusion protein can be correctly recognized by coagulation factors and the extent to which it can be recognized, there are many uncertain factors in the process of its hydrolysis into two proteins, which leads to adverse effects on its therapeutic stability. influences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double function infusion protein for thrombolysis and anticoagulation , its preparation method and uses
  • Double function infusion protein for thrombolysis and anticoagulation , its preparation method and uses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] 1. Obtain the target gene sequence by PCR

[0027] As shown in Figure 1, according to the known gene sequence, apply the end-added PCR method in the r-PA gene (the J1 plasmid in Figure 1 contains the r-PA gene shown in SEQ ID NO.4, the aminoacid sequence of its coding Respectively as shown in SEQ ID NO.5 and SEQ ID NO.6), the 5' end adds 12 peptides (55-66) of recombinant hirudin HV3 and the gene of GlyGlyGly connecting peptide, but because the added end sequence two is greater than 60bp, it may The inaccuracy of the PCR results was caused, so the PCR was divided into two times in order to improve the accuracy of the PCR.

[0028] 1. The first round of PCR

[0029] Using the r-PA plasmid as a template and primers 1 and 2 as primers, TaqDNA polymerase catalyzed amplification to obtain the first-round PCR product P1.

[0030]Primer 1 (SEQ ID NO.10):

[0031] GGAGACGCGTACGATGAA GGTGGTGGT TCTTACCAAGGAAACAGTGAC

[0032] The underlined part is the connecting peptide sequ...

Embodiment 2

[0059] Example 2 Preparation and biological activity detection of fusion protein of hirudin 11 peptide and r-PA

[0060] The basic process is as in Example 1 above, except that the second round of PCR is different from Example 1, and all other operations and conditions are the same as Example 1.

[0061] Using P1 as a template and primers 4 and 5 as primers, TaqDNA polymerase catalyzed amplification to obtain the second-round PCR product P2.

[0062] Primer 4: (SEQ ID NO.13)

[0063] GGCTAGC TTCGAACCGATCCCGGAAGACGCGTACGATGAAGG

[0064] Among them, the boldface is the restriction site of NheI. The underlined part is the nucleotide sequence of hirudin III12 peptide.

[0065] Primer 5: (SEQ ID NO.14)

[0066] GC TTACTACGGTCGCATGTTGTCACGAATCCAGTCT

[0067] The shaded part is the restriction site of HindIII.

Embodiment 3

[0068] Example 3 Preparation and biological activity detection of fusion protein of hirudin 10 peptide and r-PA

[0069] The basic process is as in Example 1 above, except that the second round of PCR is different from Example 1, and all other operations and conditions are the same as Example 1.

[0070] Using P1 as a template and primers 6 and 5 as primers, TaqDNA polymerase catalyzed amplification to obtain the second-round PCR product P2.

[0071] Primer 6: (SEQ ID NO.15)

[0072] GGCTAGC GAACCGATCCCGGAAGACGCGTACGATGAAGG

[0073] Among them, the boldface is the restriction site of NheI. The underlined part is the nucleotide sequence of hirudin III12 peptide.

[0074] Primer 5: (SEQ ID NO.14)

[0075] GC TTACTACGGTCGCATGTTGTCACGAATCCAGTCT

[0076] The shaded part is the restriction site of HindIII.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fusing protein with plasminokin and anticoagulant function and DNA sequence to code the fusing protein, carrier with the DNA sequence and making method of fusing protein, which provides the application of fusing protein to prepare functional drug with peptide segment of continuous amino acid sequence as connecting structure, wherein the fusing protein connects 10-12 amino acids in the 55-66th amino acids sequence at IIIC end of hirudin with r-PA as t-PA bobbing mutant.

Description

technical field [0001] The present invention relates to a fusion protein with dual effects of thrombolysis and anticoagulation obtained by DNA recombination, a DNA sequence encoding the fusion protein, a carrier containing the DNA sequence, a preparation method of the fusion protein, and the fusion protein is prepared The application of drugs with thrombolytic and anticoagulant effects, and the application of peptides composed of continuous glycine sequences as linking structures in the preparation of fusion proteins with dual functions of thrombolytic and anticoagulant. Background technique [0002] Thrombolytic drugs and anticoagulant drugs are currently two types of drugs for the treatment of thrombotic diseases. [0003] As the first generation of thrombolytic drugs, there are staphylokinase (SAK), streptokinase (SK), urokinase (UK) and so on. Human tissue plasminogen activator (t-PA) containing 527 amino acids is a second-generation thrombolytic drug with high specific...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62A61K38/16A61P7/02C07K14/435C07K14/745
Inventor吴梧桐余蓉韦利军李灵玲高玲
OwnerCHINA PHARM UNIV