Recombinant virus vector for gene introduction in lymphocyte

A lymphocyte and genome technology, applied in the field of recombinant virus vectors

Inactive Publication Date: 2011-06-22
THE RES FOUND FOR MICROBIAL DISEASES OFOSAKA UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

HHV-7 strain binds to the CD4 receptor on the cell surface and proliferates well in SupT1 cells, but it cannot infect SupT1 / HIV cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant virus vector for gene introduction in lymphocyte
  • Recombinant virus vector for gene introduction in lymphocyte

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[1104] (Preparation of recombinant herpes virus)

[1105] (1: Preparation of BAC plasmid)

[1106]Plasmid PHA-2, a kind gift from Markus Wagner and Ulrich H. Koszinowski (Adler et al., (2000), J. Virol. 74:6964-74), was used. In order to prepare the recombinant virus, the insertion position of the BAC vector was selected in the center of the region of about 4000 bp of gene U21, gene U23, gene U24, gene U24a, gene U25 and gene U26. This is based on the consideration that insertion of foreign nucleic acid into such non-essential regions does not affect the proliferation of herpes virus. figure 1 is a schematic diagram of a protocol for inserting a BAC vector into the HHV-7 genome.

[1107] Using the genomic DNA of the herpesvirus KHR strain as a template, use primers BAC7-E1 (ATGCGGCCGCGCGAGTGATAGGTACTTTCT) (SEQ ID NO.: 402) and BAC7-E2 (GCTTAATTAATATATAAGTCCTTCAATAGC) (SEQ ID NO.: 403), and primer BAC7-E3 (GCTTAATTAACATGCTCTGCAATGCAAGCC) (SEQ ID NO.: 404) and BAC7-E4 (ATGCGG...

Embodiment 2

[1122] Characteristics of Recombinant Herpes Viruses

[1123] 1. Propagation of Recombinant Viruses

[1124] Propagation of the recombinant herpes virus prepared by the method described in Example 1 was confirmed.

[1125] Umbilical cord blood mononuclear cells were infected with the recombinant virus and cultured until day 7. Then the virus-infected umbilical cord blood mononuclear cells were mixed with SupT1 cells for culture. (3,000rpm, 37°C, 40min centrifugal mixing). When the infected cells were observed under a fluorescence microscope, cells with GFP expression and cytopathic effects could be confirmed. The results indicated that the recombinant herpesviruses of the present invention spread between cells and maintained the ability to proliferate (data not shown).

[1126] 2. Comparison of proliferation of recombinant viruses

[1127] In addition to the following TCID50 method, methods for comparing the proliferative properties of recombinant viruses with wild-type v...

Embodiment 3

[1131] Using the method of the present invention, a herpes virus having a herpes virus genome into which an HIV silencing gene (for example, an antisense nucleic acid against HIV) has been introduced can be easily prepared by the following steps.

[1132] A shuttle vector is prepared, in which the NFκB / Sp1 site of the U3 site of the LTR of HIV is effectively connected to the upstream of the HIV silence gene, and its two ends are connected to the flanking regions of non-essential genes of HHV-7. The shuttle vector and HHV-7U21-27-BAC plasmid (plasmid containing HHV-7 genome and BAC vector sequence) were introduced into Escherichia coli. As a result, in Escherichia coli, homologous recombination occurred between the HHV-7-U21-27-BAC plasmid and the shuttle vector, resulting in the introduction of the foreign gene (HIV silencing gene) contained in the shuttle vector into the HHV-7U21- Cointegrates formed in the 27-BAC plasmid.

[1133] Next, the shuttle plasmid was removed since...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

It is intended to provide a recombinant herpesvirus; a process for producing the same; and a pharmacological composition comprising a recombinant herpesvirus. Further, it is intended to provide a vector comprising a herpesvirus genome gene and a BAC vector sequence; a cell comprising such a vector; a fragment capable of homologous recombination with herpesvirus genome; and a nucleic acid cassettecomprising a BAC vector sequence. The objects have been attained by the development of a process for producing a recombinant herpesvirus in which use is made of a BAC vector sequence.

Description

technical field [0001] The present invention relates to a recombinant viral vector for introducing a desired gene into lymphocytes, in particular, a recombinant human herpes virus vector prepared by using BAC (Escherichia coli artificial chromosome), and a pharmaceutical composition containing the viral vector. Further, the present invention also relates to a vector comprising human herpesvirus genome gene and BAC vector sequence, and cells of the above vector. The invention also relates to methods for preparing recombinant human herpesviruses. Furthermore, the present invention also relates to a nucleic acid cassette comprising a segment capable of homologous recombination with the herpes virus genome and a BAC carrier sequence. Background technique [0002] In order to treat various diseases that target lymphocytes, such as human immunodeficiency virus (HIV) infection, it is urgent to establish a technology for gene therapy targeting lymphocytes. However, a satisfactory ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K48/00A61K35/76C12R1/19A61P31/18C12N7/01C12N15/869C12N15/38C12N1/21A61K35/763C12N5/10C12N7/00C12N15/09C12N15/86
CPCA61K2039/5256C12N2820/55C12N2710/16543C12N2710/16532A61K35/763C12N15/86C12N2800/50A61K39/245A61K39/21A61K48/00A61K39/12A61P31/18C12N2740/16034C12N15/11
Inventor森康子忠垣宪次郎武本真清高桥理明山西弘一
OwnerTHE RES FOUND FOR MICROBIAL DISEASES OFOSAKA UNIV